Description :
From Genome Similarity Track
Location :
Scaffold_383:25275- 36056
Transcript NameFunction/comments
Phypl_g7694hypothetical protein PHYSODRAFT_354938
Phypl_g7695hypothetical protein
Phypl_g7696conserved hypothetical protein
Phypl_g7697glutathione peroxidase, putative

Sequence
10781 bases(100 bases per row)
GCCGTTGGTTACGAAGAGCTTCTCCGGGTCCACCTCGTGCTGGTAGCCCTTGGTCAGGAACccggccagcgtcttgcggaACTTGGGGTAGCCCTTGATT
ACGCCGTACTGCAGGAACATGGGGTCCGTCTCGGCGAACTTGAGCGTGGCGGCCTCACggatcttgtccagcggcagcatggcCGGGGCGGGCTGGCCCA
CCTTGAAGTTGATCATCTCGTCCGCCTTGGGCACGTCGTACTGGCCGTAGTCGCCCATGCTTGCGTCTCGTCTTTCTTGCGCTTTGGTCTTGCTGGGAAC
AGGTCGAAAGGGGAAGTGGGCCACTCGCTCGTGAGGAGACGTACGTAAGTAAGGCGAGTGGCTACGCGAGAGCGCGCCTAGTTTGAGGGACCTGATGTAA
GGTGGCAGAGCGCATCTCACTTGGATGGGCCATACACTTGACAAGTATAACTCCGACGGCGGCTGTTAAAACTCCTCTTAAAATAGGAAACACGTGGTCT
TAAGGTAGGACGGGAGCTGATGTGCAAAACACGCCGAAAACGAGAGCGATTGGCCAGGCCGCCTCTTCCCCGGATCGGATTGGATGAGCATTCGCCGGTA
CAGCAAGCACTTGCCACTTGCTCCAGTCACCAACAGGAGacaacgacggcgccggGATGCACGCTGGGGCTGAGTGCGATTGCAGTCGGCGCTGATGGAA
TTGGTACTATTTGATTGAGTTGGagagagctgctggtgcacgaCCAGCGACCTGGGTTGACGGTAAGCGCTGCGTGTATGCTGACACGGGGGCTTGACAA
CATTCGTTCCTCCTCAGATGTTGCCACTCCAGACCGACAGATCGGAACCCCAGTGTGGGATGGCGATATCCGAGGAGGAAATAATGTTTTCGCAGAGAGA
TCTCGATCGTCACCAGCTATTGGCAGGAAACACTCCACCTCACTGAAAAGGAAGCACGTTGACTGGGCTGGGCGAATGACTACCGGCATGGAAAACCGAT
CCGACGCTTGCAGCACCGATGCATTTGATCGTGAACACTGGATCTAGCTGGTGTGCGTAAGTATCGAGCACACAGTTTCCTGATAATATACGAGCAAAAG
TCGATGCCAAGTTGTGGTTGATTGAAATCTTGCAACGTAGGACCAGTTCTCGGGGTTTTACCGGTTCGCGACAAATCGGGGAACTTGTCGCTGCATGATC
ACATCGCGAAAGTGGTAACAATTAGTAAATATAATATACAACCTTTCCTTCTATCGTCTGCTTAACACTGGTAGGCTACCAGTGGTAGCGGTAGTGTGAT
TACGCTGCTCAGTCAAGACTACCGATTGCCAGTGCTCCGTACGCTGCTGTAGTTGCCACGTCAGCTATTCTCAATCGCTCCTCACTCGACAACAACAGCC
TTACCAGCTACGCGCGCAGATGCACCGCAACGCCCCCGTCGAAAGCACTGACAATCCACCAGCCGACTCCCGATCAATCGCGGTTTGCAAGCttgatgct
gccgtcgtggcgctccAGGGGTCCGATGGGCACATCCAGATGAACTTCCCGGCGGAAGACGCCATCAACTTGCAGATACCTGTCCCCAATGTATCTGAAC
GCCAAACACCATCGACTGAGGCACCGAATCAAGTGGAAGACGTCGCCTTGCAACCAACGACCAAAGCGGACGCCGACCAGCTCGTGTCAGTTCCGCCGTT
GATGAACATTTGCATCCTGATCGTGGGCACACGCAGAGACGTTCAACCGTTCTTGGCCATTGCCCAGCGACTTCAGCAAGACGGCCACCGCGTGCGACTG
GGGACCCATGCAGTCTACCGAGACTTCGTCATGAGCCATGGAGTCGAGTTCTACCCGCTAGGAGGCGACCCAAAGGAGCTGGCAGCTTACATGGTCAAGA
CTGGCGGCCACCTCATCCCCACCAAGATCGAGACGCTTACCAAGGACGTGCCCCGCAATCGAGAAATGATCAAAGAGATCGTGTCCTCCACGTGGCCGGC
CGTGTCCGAGGCAGATCCGGAGGGTGGAGGCCCAGGTGTGCCAGGTCGGCCATTCCGAGCGCAGGCGATCATCGCCAACCCCGTGTCGTACGGTCACATC
CACGTTGCTGAGCGTCTCCGCGTGCCTCTCCACATCATGTTCCCGCAGCCGTGGGTGCCGACCATGGCCTTCCCTCACCCGCTGTCCAATTTGGCCTACA
CTGGCAAATGGCAGAAGAGGAACTACCTCTCGTACAAGTTAGTCGACCTCATCATGTGGCAGGGCACCGAGGGGATCATCAATGACTTCCGGACGGACAC
GTTGAAGCTCCGTCCGATTCGGAACGGGGACCAGGGGCCCGAGCTACTCCTGGATCTGGGCATCCTGCACGCCTTCATGTGGAGCTCTCGACTCGTCCCG
AAGCCTGCAGATTGGGGAGAACTGTACGACGTCATCGGGACGGTTTGTCTACAGGGCCCTGCGTCCGAGTactctccttctccagaGCTCGACGCATTTC
TGGGGAACGACGGAGGACCAATCTTCGTTGGCTTTGGGtccatggtgctggccaacccGCTTGCAACGACGCAGATGATCGTCCAAGCAGCCAAACTAGC
GAACGTGCGTGTGCTGATCCAGTCCAGCTGGAGCGACATGGCTGGAGACGTCGACATTCCTGCcaacgtcttcttcctggagaATTGCCCCCACGACTGG
CTCATGCCTCGGGTGTGTGCTGTTGTTCATCACGGTGGCGCCGGCACTAcagctgctggactgctCGCTGGCAAGCCGACCTTATCGTTCGTTTCTTCGG
AGATCAACCGTTCTGGGGCCAAGCTGTTGTGAGTGCTCGGGTGGGCGTGGCCCCTTGCCCAATTGCACAACTCACGACCGAGATACTGTGCAAGGCCTTC
GTGGACCTCGCGAGCCCAGAGCTACGAGAGAGCGGAGGCGATGCGAGATCTCATGCAgcaagaagatggcgccgaAGAGGCCGTCCGCAGTTTCAATCGC
CACTTGCCGTCGCAAGAGATGTGGTGCGACTTGGACCACCAGCGCATTGCTACGCAGTGGAGCGTTCACGACAAGATGAAGCTTTGCGATCGCTGTGCGT
TTGTTGTGGGGGAGCGGCGGGGCAAGCGGAGCCACAAGTTTGTGCGCTACAACTCGGTCGATTACTCTGCTCGCGGTcccagctcgctcttgacAGGAGT
AGCAAGTGGTGCCGTCGTGCTTGCTCACGAATTGACGGGGGCAGTGGCAGGTGTCGTGTTGCAATCAGTGAAAGGTCTAATTAACGGCGGTCTTGTCGGA
GCTGTGAAGGGCACGGTGGCTGGTGTGTGCTACTTGGTAGTGAGGCCAATCCATGGTGCAGTGCTTTTCGCGGACCACGCAGCTACAGGTCGTAAGAACG
CAAAGCGAGAAGAGGGTCATCGGAAGCTCAACAGTGTGTACGACAAGCGGCTTATGGCAGCACTCGGAGCCACAGACGCTCTGGCCGACACGCACTGCTT
GGAAATGGGCCCCAATGCTGTTGACATCGTGATTTTTGCGCGACGCAAAGACCGCAGCAAGATGTTCAAGCAGTTGGGCATTTTGACAAGCGCCGCTATC
GCACAAGTTACGAGGCCTTGGCGAAAGCTGACAAGACCAAGCAATTCGCCGCCCGAAACAACGGAGTGTTGTTCCCCGTGACGGCGGAACCTTTACGCGA
GCTGTCTGAGAAGgtgaccaccaccaccaactgCACCAATTCAAGCGAAGGGGTTGCAATTGATCTGCTATCCGCCCAGGTCACAACCATGCCAACTGGC
ATGGTTGAGATCGCGCTAAACATTCCGGATGAATCTGCAGACATCATGGAGCCCTCGACTGTGGCTGAATGGGAAGAGTACTCAAGCCGTAAGCATCTAC
TCCAAAAGCCAGAGCCTGAGTCTGTGCCAGCCATGAATATCTGTCTCGGTGCCATTGGCACATGGAACAATGGAGTGAAGCAGTTCGTAGCCATCGGCAT
CAAACTCAAGGAGCAGGGACATCGTGTGCGTGTTGCCGCCAACGAGCGTTTTCGTGCAGAGATCACGGCTCGCGGCCTTGAATTCTATCCACTTGCGGGG
CCCCCGAGAGTATCCAAGACTTTGCCAGTTTTGTGTACGAGAGTCAGAaggcagcacgagcggcagtGCCAGGCAGACTTGGTACAGGGGCTATCCAAGC
CTTCAAAGAGCTTATTTACTCACTCTGGCCAGCGGCTTACGGTTCAAACCCTCATGGCGGTGGTTTGAATATTCCTGGAGAACATTTTTGTGCGGACTCA
CTGTTATGGCAtccgctgcttcttggccacgtccacgtagCAGAGCGACTCGGTATTCCGCTTCAGTGTGCGAGTTTGGAGCCTCTCTCGCCGACACACT
CATTCCCCCACCCTTTGAGCTCCATCGCTGGTCTAGACGCGAAAGTCATGAAGCAATGTCAGAGTAATCTGCTGACGTATGGACTGCGCTCTGGCACGGC
GGGGTGGCCGAAGTGCTGACCCAGTTTCGAGGCTTCATTGGGCTAAACCAGCGTTGTGATCAGCCCGATCCGCTAGTCCGATGGGAAGTCCCTCATATCT
ACCTCTGGAATCCTGCATTGCTGCCGAAGCCGCTGGACTGGGGAGCTGAGCTGTCGGTGGTCGGCCATGTCACGCTAAGCACCAGCGATGGTTTCAGCCG
ACGCAAACAAAGAAAGCGAGAGAAAGAgagcaagcgcttcaagtGGCCGGGTCCACTCACAGAATTCGCTTTCCAGACGCCATCACCGCCAGTCGTCTAC
TTTGACGTTTCCACTCGGACCATGCCACCTGGCGATCTCGACGAGCTACTGAGAAAAGTTGATGCCGCTGCAGGTTCTTCTGGACACCAGGTTCGGGTAT
TCTTCCAGACTCGCGAGGTCGGTGATAAGCAGAAAACACTTTACCAATCTGCCAACGTTATCCAGCTTGCAAGTAGCATATCATACGCACGCCTTTTTCA
AGAAACAGCGGTGGCCGCAACGATCCATTGGGGGGAGTCCGACATCATTGCTGAGGGCCTCTCAGCTGGCAAGCCCGTCGGTATCTGCGGCGCACACTCG
TCACAACGATTTATGGCCAACTTGTTCAAGCACGCGAAAGTAGGTCTGCCGCTGATCGACTGGAGGACGTGCACAGTGGGGTCCCTGGCCTCGAGCTTCA
GAGACCTACTCGAGTCGGAGATCCGAGAGAAAGCGCAGTCAATGGCCTCCACATTTGACCTCGAACAGCCAGTCACCGCCGCAGTGAAGGCCTTCTACGC
AAACCtactgctggaagcgatgCGCTATGACGTGGAAGCAAGCAATATCGCTCGAGTATTTGACCCGCACCACAATCTGAAGTTGTCACTGCAGGCCTAC
GTCACTGTCCAGCCTCAGCGTGACGAAAGCAAGGGTTTCGTGCCGTACAGGCCTCTTCGCTACAGGGGGAACCTCCCTCCGATATTTTCCATCCAAGACA
ATCCAGCGGAACGACAGCGCTTTACCAAACCAACTTATCCCCGAGACACGGTCCGCTTAACACTAGCGTTCCTCGAAGCTCAGGGAAGTGAGCGCACCAG
CACATCAAGCTGCTCCTCAGTGATGTCCACCCGTGCCAGTCTTGTTGCTACCCCAGAAGAGATCGAAATGTTTTGGTCGTCTGttgaggaggaagctgca
gtacGTAAGGCCACAACTGCTGCCTATGAACGTCTCGTGAAGGAACCTCAACAAAAGAGCAAACGCGAAGCAGTGATGCGCTTCTTTGGCCTTCGGAAGG
AAGCATTGCATCTCGAGGTGGAGCAACTAACCTCTGTGGAGTAGCGCCACCCTTCAAAAGCAACACACAGCAGAAGAGAAACACGTTAGCACTAAGCCAC
TAAACACACATGAATCAATTCTTACCTGTTAGCCGGAGAGACACAGTGAGATCGGTAAAGGCATGAGTAACCTGGAACTCAATGCACGTGAACGAGGTGA
GATGGTTGGCGGCAGTCAAAACCTCAATTCCAATGTAATGAACCATTATCTAGTGTCTCAAGTGTAAATTCGCAACAGCGAGACGATTTCTTGCTGGCAA
ATGGGGCACGTGGGGTACTCCGACGTGCAGTTGCGGCGATACGTCTCGGCATCCTGCTCACAGAAACACAGGTGGCCGCAAGGCACAACGGCGGTCACTG
CCTGCTGGTCCTTACACACCACACACTCGGTCTTCTCGTGGATCACGGCATTCTTCAGTGCGTGGACGTTGCGGTCCACTTCTGCCAACAGGCTGCGTGT
TGTCTGTTCCAGCAACCGCTTCTGatcggccacgagcgccatcTTGTCGTTCATCTGCTCGCAGAGTTGATCGTACCGTAACTTCACCGAGTTTTCCTGA
TCCATACGCGTCTTCTCGAACGCGAATCGCTTTTCAGCATCGCGGAGCAGCACCCGGAGTCGATCCACTTCCAATTCTGCACCATCTAGCTTTGTCAGCG
AGTCATTCAGTTGGTCGAGGAATTCCTCTTCACGCTGCTTCCACTTtcgacggagctgccgctcgcctAGCAATCGCCGCTGCCATTCAGTCTTGATTTC
TGcgttgcgcttcttgaagtgCTCAAGCTCACTCATCAACGACGCAATAGAGGGTGTATTGTCGTCGCTACCCGTGCAatcctcgtcatcatcatcggCC
GCACGGCTAATCCTGCGTCTCCTGCCAGACGGTGGCCGGGCAGCGCCCGAGCCGCTACCCGCACTAGCATCGGACTGAACTTCGTTTTTAATCTGAGCAG
CACCCTTCTTCGCGTTTGACCGGGGCATCGTTTTGGGTTTTGCAACTGGCGTCTCCGGATCGCCTGAGTTACCACTGCATTGCTGTTGAACAGCGGCATC
CTGTGCTCGCTTTCGGGCTCGCTCACGCCGGCGTTGAGCTTTCAGTTTTTCTTTTTGTTCTGCCGCCAACTGAGCATGGTTTGGTTCCTTCTTGACCTTA
GACTCAGGTGGGCCAATCCAGTGACTCACATTGCGCACTCCACACACCCAGCAGTTCTGTCTTCGACTAGGGACCATCCACCGTGCGGCAAACACCTCCG
TGGGGTCGATGTTGATGTAGCCGTCCTGTTCGTCACTATCCTCACCACTTGGATTAGTTACCACAGCCATCATCGCTTCGCCATCTGTCTGTTTATCCTT
CGTCATGAGCGTTGGAGTGTAGACCTTCATGGGCGCTTTGAATTGCGCATTTTCCGAGGCATTTTTCCCAATGATGCGAAGCTCCGCCCTCTCACTAGAA
CCTACGTCAGGGAGCTTGTTCGAGTAGTAGAAAATGCCCTCCGTAGACATGGCAATGATAGCCTTTCCGTCATCACTTGCAGCCAAGGATTCGAGCATGA
TATTGGATCGACGCGATTTGCCactgccaccaccaccaatcTTTTCCAATCCAAACTCTTGGCGAGGCAGTCGCTCACAGGAGCTGGAGTTCAGGTACGA
AGAATCCGGGAAACAGATCCTATATGCTTCGCCCATGAGTGAGATACCATACGCGCACTGGCCATGAATGGCAACGATGTCCGTGGTGTTCTGCATGGTA
AAGTGGGTATTCACCGTGTGAGCCCCCCCAAGGAAGCTAGtatcttcttcagctgcagaGTAATCGTTGCTTTCCGCCACTGAGCTGGATGACGCCCTTT
TGAATTCCAGCGGCCACACACGCATATTCCTGTCTTTGCAGACCGCTGCAATCGTCAATACTCCAGGAGACACGCTTGATGGGAGAAAACCTCCCATCAT
TGCTGTGttgcctccagctccgaaGTTATGCAAGTGCTCCCAAATAGGATCCTGCTGATACCGTTCAGGCTCCACGAAGCGCCACAAATTCAGATTGCCA
ACACCCAGACCAGTTAGAATGTAGTATGCAGACCTGTCAATAGTGACGAAAAAGCAAGACAAATGGCGGAAATTCGTTAGCAGTCATAATTTTCCAAATA
AAGAACACGCCGTACATAAAAATAATGAAAGATTCGCTTACCTTTTGCTTCCCTGCTGCTCAATATCGGCAGGTGGGACATACGTCGTCACATCGGCAAA
GCCCTACATTATCAACACACACGCATCGTGAGCAGCTAATACGCAATAAAGCCGCACATGCACAGGTTACACACGAAAATTACCCGAAGTTTGCCGTTGG
AGTAAAAGTGCTTCTGAAGTTGCTGGAAatcttcatcgtcgccatctaCATCGCATATTCAGCTTTAGTATAGATCGCGAAGGATTCCGCGTGAAGGGCC
ACAAGTACACACCTTTCTGGTTCCGGTAATTATCAAGATTGATACTCATGACGACGCGTGGGCCTTGTCGGCAGCCCACAAATACAAAGCGGCCATCAGG
GGAGATTTTTACACGCAGGTGCACGTTAGAAGAGCCCTGCGAGGACTGCTCGTCAATGTGGCCCAGGAGGTAACCATGGCGGTCACTAGGGACGCTACTA
TCCATTTCGTAAAGCCGCACCGAACCGTCCGTAAATCCAACCACGATGATTTCACCATCCGGGGTAACGTCCAACGCTGTAGCCACACCTTCAGTTGAAA
AGCAGATCGATCTCTGGGCAACAACCGGGCGAGAGGCGACGAACAACTTCCGCACAGGTTTTGGTGGCTGTGTCGGGGTGTTGGAAGGTCGAGCAGGTGC
GGAAGCCGACACCCCAACACTAACTGGCGCCAAAGAGGTTGGCGCGGCACTGGCATCTCCGGCGGCACTCGCcgaagcaggtggagcagaagatccagac
gatgaagctgcagcaagtgtaCTAGAAGTAGCAGTgacggcagcaggagcacgaGTAGACGTCGCCATGGTGTGCTGTGCAATAGCCTCCTCTGGGTGAG
CCAGATCCACCATCACGGGTCCACTCCGCGGCACATTTAACTGCGCCGCGCTCGCACCAGCCCCTGGactgctcgtcgtcctcgccggTTTCGCAGGCGA
CTTGTTAAACTTGGCCTGGAACGACTGGAACGGCGACTTGGCTGCCCTCACCACCTTGATCGTCTTGGCAGGAGGCGCAACTTCCGCCTGGTCCAACGCG
GACGACAACAGCGGCGGGTGTCCATCGATCCTGGCCGAAGAGGCCGCCGGCGCAGCTGCGTCCCCCGCCATGGTGCTGTCGTCGAACACCAGCGGCCTCT
TGGGCGAGGCCGAGGCTCTGTGTCTCAACGGACTCGTGAGGAACTCGCTGCGTCGCAGCGGACtcgccgcggccgcgctcctcctcggcctcgccgGACT
GGCCAGCACCGAGCTCCTCGGTGGCCGCACGGGACtcgacagctgcagcgggtTGACGGCACCTCTGGCCCGCGCGGGActcgccagcggcggcgtcggg
ctCTTCAAGTTCAGCGGGTGGTTGTGACGCCGCATGGGGCTCGTGAAGCCCAGGGGCGCCGCACTGGGGCGCCGAGCGGGGGACAAGATGCCCGCCGCGA
CGGTCGTTCTGGTCGCCGCGTCGCCGTGCGGGGgcgacgtcttcttcctcttggcggcgcgctcggcctcgtccgcgCCGGGGGcgtcctcctgcagctg
gcgcttcttcttgagcgcctccacgaTCTGCTGCGCGCGGTTCTTGGTGCTGTTGCGCGAGCCCGCCACGTTCTTCATGATCATCTTCTCCATGTTGAGG
CGGTTGCGGCGTgcctcgtcgctgttgcgctgcggcttcttggccagcggcagcgcgggGACGGCCGGGCGCGGGTTGCCATTGCTAGAGTGATGGTCGT
TGCTCGCCATGTTGAAGGCTATAAGACCCGCGCTGAGTGCGCACTCGATTGTTGCACTTCCGCCCTATCGCTCTTGGGGTGAAAGGCGAGCGCGGAGGGA
GCGAACGCGCGCGTTTGACCAACTCTTCGCGCCATTTTTAGACGGCCTTCTCATTGGTCGATGGTTTAGTTTAAATTTGTCCAATGAGATGACGTTGGTG
TGGCACCACACAAAACGCAAATTGAAGAGATCCGATATGGGGAAGatgcggtcgctgctgctgctggcggcgacgctgactGCTGCTCTGCTTGGAGGAG
CTAGCGCGGCTACTCAAGCTGGAGAGGAGACGTCGTTCCTGGACTTTTCGGTGCCGGATCTGCAGGGCCGCCTCGTTTCCATGCGCGAGTTCAACACCTT
CCCGGTCATCCTCGTGGTCAACGTGGCCAGCGAGTGCGGCTACACGGACAAGAACtaccgcgagctgcaggtggcgtgCAATGCAATAGAACGCTGTGCA
GGGCATTTTGCAATACTTTCTGTGGCTTGCACTCATTGATTCTGCGATACTTGcaggagctgtacgagaaaTACCACGACGAAGGGCTCACGGTGCTGGG
CTTCCCGTGCAACCAGTTCGGCGGCCAGGAGCCCGGAACGGCGCAGGACATCCGCAAGTTCACGCAGGAGAAGTATCACGTGACGTTCCCGCTCTTCTCC
AAGGTTGGTCGTGGTGGGGGAGGCTGAAGAGTGGAGAGGATTCTGATGTTTGTGTTGGTTGTTGCGTAGCTGGACGTGAATGGCGAGCACGCGCACCCGC
TGTTTAAGTTCTTGAAGAAGCAACTGGACGGATTCGTCACCAACGACATCAAGTGGAACTTCACCAAATTTCTGATCGTGAACCACGAGCCGTCTAAGCG
GTATggctccacgacgtcgccgctggagaTCGAGAACGACATTGTGCAGGCGTTGCACAGCAGCCGACACGTGGACGCGTT