Description :
From Genome Similarity Track
Location :
Scaffold_426:2527- 4621
Sequence
2094 bases(100 bases per row)
TTAATCTCGTGGGATACAAGTATAGTATAACATATATCGAGCATCCGGAGTAGAGCTAATACCTCTTTCTCCACCACCCCGTAATTAACCTCGTTAGGCT
GTAGCGTACGACTCGAGAAGGTGACAGGCCAATATAGACCATATATTCTTGAAGCAAAGCCGCAGATACAGACCATTTACTAGCATACGCAACAATCACC
AGCGGTCGATCGGGGTCGAAATGCTNNNNNNNNNNCACACCATCACATTCTTACAACAAAGCCGCTAATGCAGCCCACTTACTAGCATACACGACGATCA
CANNNNNNNNNNTAGCATACACAACAATAACCGGCGGTCAATCGGGGTCGAAATGCTTTAAGATCGATGCTGTGGCTATCTTCTCCTTTAGCAATGTGAA
TGCGANNNNNNNNNNTCAACGATTCCTGCCCTCAGAATCGCGATCAAACCCTGCAATGGGTACCGATCGACATCGATCTCTCGTTTTGGGGACAGATTGC
GTTTAGTTCCTTCATGCCCTTCTCGAATGTCATCAGGTTCTACCGNNNNNNNNNNTGCAGCCGTAGGCTTTGGCGCCCTATTAACGCGGCTGATTTCATG
GAAATCTGCTCCCCGCCGTTCGTACAATACTGATGCGTAAATTTCGNNNNNNNNNNCAGACATAGGCTTTGGCACCCCATTAACCCGGCTGCTTTCATCG
AAATCTGCTTCCTGCAGCTCGTACAACACTGATNNNNNNNNNNCATTAAGGCGGCTGGTTTCGTGGAAATCTGCTTCCCGCTGCTCGTACAACACTGATG
CGTATAAAATTGCGAAATTTTCAATAAATCGAATGTAATAGTTAAGACTTCCCAAAANNNNNNNNNNACCAGAAATAACTGCATCGATCGCAGCGTCAGA
TGGAACTGAATGTTCACCAATGATTCTAAATCTTTTGGATTAGCTTCCGAACCCTGCGAGCGAGATTTGATGTCNNNNNNNNNNCATCTATCGCAGTGTC
CGAGGGGGAACGGGATGTTCACCAACGGTCCCAACTCTTTCGGATTACCTTTCAAACCTGCGAGCGAGATTTGATGTCNNNNNNNNNNNCGCACGCCCCC
ATAATCTCTCCACTTTTTCACACATGAATTTCCGCGATGTAGCTGGTATCAATACGTCTTCGATATAAGATCTTCGAGCCAACACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCGGCCGTGCTCTATTCGGATCTTGCGCCGGTTTTCAGATACCCATACAGAGCATTATCGATCAATCGCTGGTAAATCCGTGAACCTTTTT
AACCAGAGAGGCATCCGATCCGCAACCACTCAACCAACCCTGATGGTGCGATAAAGGCTGGAAGCGCTCTTGCCCTTTCAGTCATTCCCACCACCCAAAA
ATTACTCGCCATGTCCAGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGGGTCGGATGATCTTGGCTGAGAGTAATCCTTTTATCAGATCGGCTTGTTTCTCTTGAAATTTGGGAGCCACAGGTCTGATTTTCTGCGCG
ACCGGATTTGCCCCACCCACATCTATATCGCAAATGCCCCACGCGCCGCAGGTGGTAGGGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC