Description :
From Genome Similarity Track
Location :
contig_21:25265- 27310
Sequence
2045 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACCTCGACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTATCTGTCGACACGACCGC
GTCGCCCGGACGCTTCGAGACCCTCTCGAATCGGAATCAGGCCCTGCGATTCGTTTACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGG
GGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGTGGAGGGCCGCATGACTGGTGGAGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGC
CATCGCTCTGTCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACC
ATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAA
CAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTT
CGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAG
ATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTT
AGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGCGTAGTGACCGATGTTTCCG
CAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTACC
ACCGGTCGTGGCATCAGCCGCGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAATCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTT
GGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGT
TCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGG
GGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCCTCGTACGTGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGT
CCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAG
GTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACG
CTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATGATTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAG
TCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTG
TCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCT
GCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTAATTAAGTTCAGTATACTTGTATCCGCAAGTATACTT
AAACTAAGACAAAGGACCGAACGATAGCTTTGGTGCTAAATGAGA