Description :
From Genome Similarity Track
Location :
Scaffold_75:25260- 28224
Sequence
2964 bases(100 bases per row)
CGCACAATCACTTTCGCGTTGCTGCCGCTGGCAAACGCGCGCATCGCAATGCTACTGCGTCAATGTTGAGCCAAATGATGGAGGGCGAATGGCCATACAA
GCAAAAAAAAGTGAATCCATATCTGGCAGCCTGAAACGGCTGCTTGGGGAGATGGACCAGAATGATTGCAGAGCTCCCGTTGGACAGCCGAGCAGCCAAC
ATTCTGACGCGCCTTACAGCCTCCAAGTGAACCAAAAGTGTAGGTTCAGCAATACGGTACAGCGAGTGGGTGGGTCATGTGTGCCTGTCCCTCCTCCCCT
CTCGCTCTCCCGGCTGGTAAATTACCAAAAGATCCAACCTCCCCTCTCGCTTCACTGAGCAGCACAGTCCCAGAGTCCCTTAGGATCCGCTCACCAAATG
AGCGAGCGCGGTAGAGGCGAGTCTCGCGAGTGAATAAAAAAAAGAACTTTGTTCGAGTTTGCATTTTGCCTCTCCAACTACAACATGGCTTCACATTCTC
CAAATACCTGTTCTCCTGCTGCGCTCTTGACTCTTGAGATGGTTCGTTTGCGTATATATAGTTCTTATTTAGTCGCATTGGATCTGTGGCATCTCCCGCA
TATATACAGCAATAGAATCTTTTTGCTCTTCTCTGGTCCACCCTCTTGCAGAATATGCGTGTGCGTGCATATTCAGCCATGGCTGCATGCCTCTCTATAT
GCTTTCCTTTTATTCAAATATATATACAGCATGCGCAGACTGCACGTGGCATCTTTACTCAACTATACGCACATTTCAGAGGATACATTCCTATAAGCAA
AGTGTGCACACACCTCATACTAGAGAGGGAAATTGAGGGAGAGAAAGCATGAACGTATATATAAACAAAACAGTGTATTTGCATTTGGTGCATGGGTACA
TACATACATGTTCACAGTCTTCTAGCATCCTCCAGCAACCCATGCCATTTATTATATGCGATAAATAGCCTCCACCGTGTGTGTTTACTCTTTAAGCGAT
CCTAACGATCGCTTATGCTGTTTTTTATAAGCGTTTCGGACGTTTTTGCTCCATTGCTGTTTACTGCCTGTCAGTGTGTTGATGTTTACTGAAAAACGCG
CATGTGGCGAGTAGCTGCTCTTTCAACGTCTCATTATGGTTTGCACGCGATTAACCTAGGAGACTCGAGCAAAATCCAGGCATATCATCATATTCACATA
TGTCAGCATTTCCGCGCATATTTGACTCTTCTGGCGTATGTGAAAGATCTCACTTCGCATATCCATTTACTGACGGATGTCGCCCACATATACGCCAGAC
ACGCGCGTATGTGTACGACAAATCAGTCCGATACGCACTGCGCCATTCATCACGCGAATCTTCGCCTTTGGAGCGCAAGATATCTCGCAAAAGTCCATAT
CCGAAAATGTCGAAAATAAACTCCACAAAGTGCACATATATCCACAGCAACTGGCTTTTCCACTTCAACATGCTGCATTTTTCGAATGTTGCCTTTTCCT
GCGACATGCTGTTGCTGGGTAGACTTGTCTATGCGCATATGTCTTTCTTTGCGCACTCGTAATTTATTATCTGCTTATGTCATTTTTACCCATCGAGATG
GTTGTGCGTTGGGGACATGCGCGTGTTTGCGGCACGCTCGGCTCGTGGCTTTCGTTCCTCTGTGCGTCGCAGACGCATGGCCGGATGGGATATAATGCTG
TTTACTGCACATATGCTCGTCGTGCTTACGCTGCGCGTTGGAGCATCAAATGCGTTTGAGTGAACCGGCACCCTCACTCATGGCTGCTGTGTATTTTTTC
CGCAAATACGACATCGTATTTTTTTTTGCAAGTGGGTATTTTGTTGCACTTGTGTATGTTGTCTGTCTGTATACCCACAACATCCCCATAGCAACCCACC
AACAAGAATAACAAACAGCAAGCAAGTTGCAGTTTGTATGCGACGGTTTGTGTCAAACGACGACATGTCGATCTGCCAACAAACAGCAGCCACATGCTCG
CGTACCTTCTCCACATGTACCTACGTGCATGGCGCAAGTGCGCGCCAGATTCAACTGGCGCCTTTTGCATGTTGAAGTGCGCACAGCATGATGGTCGCAA
GCTGCTACCTGAACACGCCGGTTTTGCGGCAACGTGGGCTCATTACATCAGACATCAGACACCAGACATCAGACACCAGACGCACGGCAGTCGTGGCTAA
ACGCACATGCGCATGGGGCTTCCTGCATATTCATATGATCACCATGTTTTGCATCCTGCTAGCTGCGTGTCGACTTAGCTCCTGCTCTCCTCGCTCGGTG
TCGACTTAGCGCCCGTCGCGAGCTCCTCCGCAAGAGCCACGTAGTCCACGTGCTTGCGCACGCGCTTGCTGCGTGACACGGCCATGGACTCCGCCTCCGT
CTCGTGCTGCTCCTGCTCGTGGGACTCTGCGCCGCTGGCGCGCTTCTTGCGCGTCGCTGCGACCATCGTGACGCTCGCGGGCGCCATAGTGTAGTTGGCC
AGCAACACACGCTCGTGGGCTGCTTCCTTGGCGACGTCGTGCATGTCCCACGCCGCGAGCGTCGGCAGCACGAGCGCGCGCGCGTGAGCGGCCACGCTGC
GCGCAAAGGGCGAGACCATGCGGCCGTGGAAGTTGTAGCCGCCCTCGAGCACCGACACGACGCGACCGTGGCAGCACGCGTGCGCGACGCGCCGCACGTG
CGCCACGAGCCACTCGTAGTCCTGCTCGAGCAACGATACGTAACCCCAGTTGACGCTCTCGCGCTTGTGCGCGTCAAAGCCTGCTGAGAGGAAGATTAGG
TCCGGCGCGAACGCGCGCAGCTTGACGAGCACGTCGTCGCGGAACGCGCTGCGCCACTGGAGCCGCGACGCCGACGCGCCCTCGCGGCAGTAGCGCAGCC
CGATGTTGTAGACCAGCGGCGCGTCGTCGTCGTCCTCGCCGCGTGCCTCGTTGGTCTCGCCCGA