Description :
From Genome Similarity Track
Location :
Scaffold_12:252478- 254640
Sequence
2162 bases(100 bases per row)
GTGAGTCGACTGATCGTTCAAGATGAAAGATCCGTCCACGATTCCGCTGCCGCAGACACCCCACCGACACGAACGTACTCCTCCGACCAAGCTTGGAGCT
GAGCGTGGTGCCTTTGGCACTACCGAAGTTTCACCGTACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGCAACGTGTTTACGCTG
GTATCGAGGGTTCGTCTGGTCGCCGAGGTGATCCGCGAGCTCCCAAAAGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGTTCGTCCAGTAACGATGA
CATTTTGGTGCGTACATTCGACGAGGAAGATCCTCAAGTCGAGTTGATGCGTCAGGTAAATGAGCTGGCGACGCTGAACGACGTGGACCCGACATCGAGG
ATTGAAATGGCATCGCACCGACCATTGGATCGCATCAAGGCGTTCTCAGGCTCTCGCAACAAGAGCGAGCACTGTATGCAGTGGCTCCGTGGGTTCGTCT
TCGAAATGACTGGAACCCACACAGATGCCAAAAAATGGTGCATTCCATTTGAGCTTTGAGCGCGGCTTCACCGTACTTTCAAGACTCGCACATGGCTACG
CTACGTTTGGAGAGCCGTATGCAACGTGTGTACGCTGGTAACGAGAGTTCGTTCGGTCGCCAGGGCGGTGCGCGAGCTCCCAAAGGAGGTGCTGGACGTC
GTCAAGTCGACAGCGATGGTTCGTCCAGTGACGATGACATTTTGGTGCGTACATTCGACGAGGAAGATCATCAAGTCGAGTTGATGCGTCAGATGAATGA
GCTAGCGACGCTGAACGACGTGGACCCGACATCGAGGATTGAAATGGCTTCGCACCGACCGTTGGATCGCATCACGCCGTTCTCAGGCTCTCGCAACAAG
AGCGAGCACTGTATGCAGTGGCTCTGTGGGTTCGTCTACGAAATGACTGGAGCCCACACGGATGCCGATAAATGGTGCATTCCATTTGAGCTAAGTTTCC
GGTACGGAGCCATTCATTGGTTCCGTCAACTTCCGCAGAAGACGAGGTGCAAGTGGAAGCTGCTGAGCGATGCGTTCATCCGCTACTACTGCTCGTAGTT
CACTCAGACGGCACCGTCACGTTACTACTCTGCCAAGCGGGAACGTAATGAACATCTGTGCGACTACAAAAACAGGCTGACTGGCTACGCTCGGACCGCC
CGTCTACACTTCGAGAAGGGTGGTCGCGACGCGAAAGAACACGTACAGTAGTTCCTGGCAACATGCGATGATGACAAGCTAGCGGAGAGTCTCTACCACG
CTCGAGTCGCCGACATTCACGAGCTCGAAGAGATCATCGAAGATGTTCTCAAGGGCAAGGAGACAATGGCCAAGCGTGACAGTGAGTACCGATACTCCAA
GAGTCGTGACGCGCGACGCGACGATGGGTACGCCCGCAACAATCGGCGTGATGACCGTCGCCGCGATGACAACCGCAACAAACCAAGAGTGACGCTCATT
GAAGCCACGGTGGGTGACCTACTAGCTGAATTAGAAGGTCGTCTAGCTGCTCAGGGAGGCAACGAGTATTCAAACGAAGATCCAAACGCTTACAACGATG
TCCAAGACGAGTACAACGACTTTCAGCCCGATAATACGGATGGTGATTTCTCATTGGATGAAAATGACCGATACCTCGCCGCTGCTAACAAAAATGAGCG
CCGTGCACCTGCTGAAGGCACCTATGCACGTTCAGACAACCGCCAACCGCGTGGAAACACGCCTGATAGCGAGAATAGCTTCAATCAAGATCGTCGAGGT
GGTGACCGTGGGTTCAATCAGGACCAACGCGGTCGACGTGACTTCAACCGCGACTGCCGACGCCCACAGTAGGGAACATGCGCGGTGTGCGGTGGCATGA
GTCACTCCGCCCACTACTGTAACAAGCGATGCAAGTTCTGCAAACAACTCCACGATGCTGGACAATGCGAACTTTTCCGCAACTTCCAAGACCTTGCCAA
ATTCGTGCGTCCAAACTGTAGCTGGATAATACATGATACAACATCACCTCGTATCTGGAAAGACAGACCAGCGTGCTCACAGCCAAAGAGCAACACTGCG
GCAGAAACCGATCCTGCCAGAGCTCAAGGCCGTCGTTTTACAACGTCATTTAAACTAGGCAG