Description :
From Genome Similarity Track
Location :
Scaffold_22:252403- 253788
Sequence
1385 bases(100 bases per row)
ACTCAAAAGCGTAAATGGTTTCTAATCAAGGCTCAATACTGTAACCAGGTCAAAATTGTGCGGGGGGGGGGTGATAGAGGTCGCGTGTCTTGGCTTGTGC
GGATAAGGGAAGAGTAATCACTCGGGGAGAAGACCGGACCGAAGACACTTGAGGGGAAGAAGGAATAAACCGAAGGGATTGATTTATCGGAGCTTACCCT
GTCCTCACTACCTAGGTCATCCAATCACCAACTGTAACGGGCCATGTGTATACTCCGTTACTTGCTTACACTGTAGTGTTGAGGAAGCTCGCAATAGGAC
GACTGAGTCTTAGGTTTAAGGAGAAATCAACTCTGACTTTATTTTACAGCCATGGCCACAGCCCTGGCCACTCAAATACACGTCATATTCCAATTGGCTA
ATAATGAGCCTTGCTCCCCATATATCAGCCAATGGCACGACAGAAATTCAGAACACGCTAGTCGTTTGCTGATGCACCTACTTATGTAAAGAAATCTACC
TACTTATGCTACATTACCCCCTCTGGAAGTTGCACTTACGCAACATAAGCAACGGGCGAAGAGCAAATCAAGCTATGTGAGGATGGCGAACGGGGACTTG
GTTAACGGGCGGAGCGAACCGGGGACGGAGAAATCTCCTGCCAAGCGCAGCAGCGACACAACTCATCTTGCGGAGAGCTTCACAAGCAACACGATGGATC
AGCAGCGGACAGGAACACCGACGACGGCGACGTCGTTGACAGCAGGGACAACAGCAGCGGCACGCGGTACGTGCGTGATGGACGACCAGCTCCGGACATG
GGCTCTCTACGATATATCCGAAGCGCGGGATCTAGACACACTGGACACGACGAAAGATCCCTTCCGGCGCTTCCGTGGGCTGCGACAGAAGTCTTTCGAT
AGTGTCGCATATGGCGTGTTACAGGAGTCGTGGCGCACTTTCATCCGGCGCTGGACTGGACGCAAGAAGAAGGAGAAAGCTTCGTTGGCTGGCTGGTATA
CCGCGAGGAGATCGTCAAGGAGCACTCGCTCACGGAACTTCGTAAGCGCGTCTGCACCAGCGCATGAGAGGACATGCGCCGTATCTATTACGTGAGGGTC
GCTGAAGGCTGTAGTGTTTGTACCGGGCCGCGTCCGACTGTCGAGAAGTAAAGCAGCCACGTCACTGAGTATCCGCTTCGTGAACAAGAACACGGGTGGT
AACGGGGCTGCACGCAAAATGCTACAAATAGCCATTCGGCTACTAAAACGTTTTTTCACGCTTGTGTGAGGTACACCAATGATTATGTTTGACAGACAGT
TGCTCTTCATGCATTTAGGACATGCTTGGTTGAAAGTCAATATCTTCAACCAATTAGAATAGTAGAACTTTGTCAACCATTCGTT