Description :
From Genome Similarity Track
Location :
Scaffold_266:25230- 27341
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_266-snap-gene-0.13Zgc:56123
Pytir_DAOMBR486maker-pir_contig_266-snap-gene-0.14Myotubularin

Sequence
2111 bases(100 bases per row)
ATTGGGATTCTGAAGTGTTTGTTGCACACGACGAACCGGTGAATCTGTCCAAGAGGTCGATCTGTCTCAAGTCTTCAATGCAGTAGCAAAAGCAAATCAC
TCGAGGAACTCTTCAAACGTTTACTGAGCAGCAACAGAGAAAGCCAAAACATACACGACAACAAGGCGTTGAATTTTATGTAGACTTACTTATTCAGCCA
TTTTCCTTCTTGCTTCGCTTACACTGGAACGTCATCGAGCTCCACGGGATTTTCCGTCAGCTTGCCAATCTTCACGTTGCTCTTCTTCTGCCTGTCACCA
CTACTACCACTCTCACCGTCCAAAGACGAAGAAGATGGTGACGACGGCGATGACGAAGTGTCCGTGAGCGCCGACTTCTCGCTCACGTGGTCGCCATGAG
ATAACGACTTGGAGGTCGAAGACGACGACGATACGAGCACGCAGTCGTCGCGAATGTCTTTCTTGAGGAAACTGTCCTGGATCCAAAACTGCAGCGCGTT
CATCAGACACGGACACGCGATCATCACGAGCGCGAGCTCCACGCGCGGGTACGGCTTCAGCGGCGAGAACACCCAGAGCGCGAGCTCGCCGAGCGGCTTC
TCGAGCGCGACAATGAACACCGCAATCACCAATTTCGTCATGAAGATGATCACGATCCACGAAAGCAGCTGCGCCAACCAATTCCTAATATCAAGCGATC
AATGCATGCGGTTGAGACCTCAACGTTAGTCCCAGACACCACAACGCCAATACAATAACCATAAATGGTAGAAATGAACTACGTACCGAACGCGGATCGG
GTTGCCATAGTCGCCTGTCACCATGACCGACGTCCACTGGAAGCGCGCGGCGAGCATCGAGAACGCTTCGAGGAAGACCCAGTTGAGAAACACGCCGAAC
GTCGTGTCCATCGTGAAGTTCACAAAGTAGAACGCGCACTGCCAGACAGAACAGAAGGGTTCATAAAAAATAAAAAACACACAATCAGTACAATATATAG
GTGGCAGTTCAGTTCATGCGCGACTGGGCTGTTTGTTGTACCTGGTCGACGCCCTTCAGCACTTGCTCGGCATCCAGCTGGTGCTGGTAGAGCAGGATCG
CGATGAGCAAGTTTGCGACGTGCGCAAAGCCCGCACCGACCATTTGCTTGGACGCGTCAAAGCCCCACACCTGTGGTTAAGACACACACATATATATACA
TATACGCACATACATAAACAAAGGATCTCCCAGTGGTCAGCCACGCATTCGAATTGGGGATTAGAGTCGACGGACGGGTGGACGTTCTCAAATGAAACAC
ACACCGCGAGTGGCCGCTGCGGGACCTCGTTGTAGCGCTTCACGATGAGTACCGAAAACGCGATGAAGCCCAGCATCACCTGCATGAGCGCCGCGAAGCC
GCCGCTCAGCAGCTTGCACTCCGGTTCATCTACTGCTGCTGCGTGTTGCGCGTCCGGCATGGCAGACACGGAACCAGATTTTTAGCTCGTCTCTGCGACT
TGGGAAGAATAGAAGAATGGGAGCAAACTGAGTTTGTCGGGTGACACCTCTTTTTACCCTTCAATACTGGTAGGGTATTGTGAAACCTGTGTGCGGCCAA
AAACGTAACCCATCTTATTGAAATTAATATAGGTCTCCCTATATTAGATCACAGTCAGTTCTAGTAAATCAAATCAAAAAATATATGTCCACTTTCGCTT
GCCACTTCCTTCACTGCACCATTTCCTCTACTTTCGTTAGCGTTTGTCGCGACGCGGTCCCCAGAAACATCGAGGGACCGCTGCAACCTCCCGCGTTCGC
TCGCGAGGTTGGCATCATCGAAGAACTCGAGGATGATGAACTGGTTGACGACGCTGCTGTTGAATGCGACGAGATCGAATCCGCTAAATCTACGCGCGAG
TGGTTGAGTAACGCGTCGGAAGACATCTTGCTCGTACTCGTTGCTCGGGTCGCCACGGGATCAAAGTACGAGTGGAAAATCTCGAAACCGGAATTGATCG
AAGCGCCAATGAAGCTGCTGGGCTTGCCACCAGACAGAATTGTCTCGTTCTGACTGTCCACCACACCGGAATTCTGCGCACTTGGCGGGTACGGCCAGGA
GCTTGAGCTCC