Description :
From Genome Similarity Track
Location :
contig_193:25227- 26439
Transcript NameFunction/comments
g14702.t1ETK73483.1 hypothetical protein L915_19586 [Phytophthora parasitica

Sequence
1212 bases(100 bases per row)
GAGCAGGCGCTGGCGGAAGCCGCTAGCTTGGCTGAGAGCGCCGTGGATGAGCGTTACTTCTCCACTGAAGACTTCGCGTCGCTACCGCTGTCCGATCCCA
CGCGAAAGGCGCTGGCTGACATGGGCTTCTCCAAGATGACCAAGATCCAGTCCAAGTCGATCCGCCCGCTGCTGGCTGGCCAAGATTTGCTGGGAGCTGC
CAAGACGGGCTCTGGTAAGACGCTGTCGTTCCTGATCCCCGCTATCGAACTGCTGCACAAGGTGCGCTTCACGGCGCGCAAGGGAACGGGCTGCATTGTC
ATCTCGCCCACGCGCGAGCTTGCGTTGCAGATTTACGGCGTCGTGCGCGACATCTGCAAGTACCACTCGCAGACCCACGGTATTGTCATGGGCGGTGCCA
ACCGTCGTGCCGAGGCGGAGCGTCTGGTGAAGGGTGTGAACATTCTGATCTCCACGCCCGGTCGTCTGCTGGATCACCTGCAGAACACCAAGGCATTCAT
TTACCACAATCTGCAGATTCTCGTGATTGATGAGGCCGATCGAATTCTTTCGATTGGTTTCGAGGAGGAGATGCGCCAGATTATCAAGTGCATCCCCAAG
GAGCGCCAAACGATGCTGTTCAGTGCCACACAGACGAAGAAGGTGGAGGACCTAGCTCGTCTGTCGATTAAGGAGAAGCCTGTGTACGTGGGTGTTGAAG
AGGAGGACACCAAGGCCACTGTCGCTACGTTGGAGCAGGGGTATGTTGTGACTCCCAGTGACAAGCGTTTCCTGCTGTTGTTCACGTTCCTCAAGAAGAA
CCTGAAGAAGAAGGTCATGGTTTTCTTTTCGTCGTGCAGTGCTGTCAAGTTCTACGGTGAGCTGCTGAACTACATCGATATTCCTGTGCTGGACATTCAC
GGCAAGCAGAAACAGAACAAGCGTACGACTACGTTCTTCCAGTTCTGTAACGCGAAGACGGGTATCCTGCTTTGCACGGATGTGGCAGCCCGTGGTCTCG
ATATCCCGGCAGTGGATTGGATTATTCAGTTCGACCCGCCTGATGATCCGCGCGAGTACATTCACCGTGTCGGTCGTACGGCGCGTGGAGCGAAGGGCAA
GGGTAAGGCCCTTCTTATGCTTCTGCCGGATGAGCTTGGCTTCCTGAAGTACCTAAAGGCCTCCAAGGTGGCTCTTAACGAGTACGAGTTCCCCGTCTCG
AAGATTGCGAAC