Description :
From Genome Similarity Track
Location :
Scaffold_409:25218- 29185
Transcript NameFunction/comments
g4849.t1hypothetical protein

Sequence
3967 bases(100 bases per row)
ACACCCATGTCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGTATGCCGAGTGGCAGAATCTAGC
TTTCCAGTCTACTACAGACCATGTGGAGGTAGAAGAGCATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATC
CTGCGTCGTGACCGCGGAGCCTCGAGATCGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAGCTGAGGGGTCTCCAAGGGATC
AGGAAGGTGGCACCGGCGATCAGGACGCGAGAGAATCTCCGCCAATGGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAGGGAGTCTGTGCCCCG
GGCCGAAACGCCTCCGATCGTTGATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAG
ATGGCAATCTTGCCGGAAGTAGTGACCACCACCGATGAAGTCACGATCGAGGATATCCAGGTGGGCGATCCTGAGTCAAACACCCCGGAAGAAATCGATC
GCCTGCGACAGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCGTTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGG
AGGAGCAGCTCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAAAGCCTGTTATCGGCGAAGATGATC
ACGCCGTCGACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTT
TGACGAGACTGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACAAAGTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTT
CTGGGTAGTCTCCATGACAGAACGCGCACGAAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAAT
GCGCCACAGATCTACCAGCGATTGATTGATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAACCGATCGACGTGTTCGATT
CAGGCGAGCCAGAACCAGAGCCGAGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGA
GAAGGTTGAAGCACTGCTCGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGAAAAGTAGACTACTTGGGACAC
CGAGTGTCCGTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGCAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTG
GAAGTTTGAACTACTACAGTCGGTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATGGTTCAGCA
GAATAGGTCCATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGATGCTGACCGTTGGGCCCGAGCGAAAATCGCATTCACGATGCTG
AAGGCCAAGATCGTGTCCACCCCGGTACTGAAACATTTCGATCCAGATCGCACCCCGGTGATCGTAGTCTATGCGAGCCAGTGGGCGATCTCCGCGGCAC
TCGTACAAGAGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATTGTCGACAAGGAAGTCTT
GGCACTCTTGCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTCG
GCTGGTTTCCAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAGATTCTGGGAG
CGATGGCAGCAAGCATCACACCTCGCGCAGAAGTAGACGAGGCGTTGATCGCGATTGCCCCAGTAAAGCAGCCCCGACAGACGATCACCATGCCACCCCC
TACGGTCGAAGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCTG
CCGGGATGGACGATCGTCACGGCCGCATCGGAGTACATGCCTGATCTGACGGTGAACGAAGCTGAATACCGCGGACTGCTGTTGTGTTTCGGTCTCCTGT
CCACTATGGACAGGGGGCGGGTCGTGATCTGCGGAGACTCCAATTTAGTGATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTT
ATTGCGCGAGAAAGCGATGGATCGGCTCCGATCGTGGCCGAGACACGAGTTCTTACATATGAAACGAGATTGGAACCAGAGTGCGGACAAGTTAGCTAGC
GAAGCTCTTCAACGAGGCGAAGGAACCGTAGTTACCTCGGAAGCTGATCGACAGGACCTGATCACACTCAATCGGCTGGACGAGCTCCTGAAGCCGAAGG
ATAATAACGCTGTAGCTCGTGTATCAGCGGTGACGCGATCGGCACGACGGTCGAGACGAGTGCCGAGAGTTCTGCAAGAAGCGATCGTGCAACGCATCAG
AAGTGAACGGATCACGCAAGCCCAAGACGAAGAGCAGTGGATCGCGAACATGAAATCGTACCTGCGGGGCGAGGTGACCGACCTGTCGTCGAACGATGCT
AAGTCCTGCGCCAAGACCGCTTACGATTACGAGCTGGACGAGAGCGGACTCCTGCTGTACTGCCCGACAAAACCGCAATCGGACGAAGACCGAGACTCCC
TCGCGCGGCTGGTCATCCCGGAGACGCTACAACAAGACGTCCTGCATCATTACCACGCTAGCCTGGAAGGCGGGCACCAAGGGATCGGGAGGACTTACCA
GCGCGTCAAGGCGCACTTCCACTGGAGAGGGCTGTTCAGGAGTGTTCAGCGGTTCGTGGGAGAATGTGTGGATTGTGAAACTGGGAAAGGGCGCCCCCTC
ATTCAGGGAGAATCGCCAGGGAATGTACAAGCTACGTACCCATTCCAAATGATCGCCATGGACCATATTCCATCTCTACCGAAGTCGTACAAAGGAAACA
CAGAGCTGTTAATCTGGGTTGACCTTTTCACCGGATACGTGATCGCGAAGGCTAGCGCCTCTCGCACGGCCCAAGCGATTGCCGAGAATTACGAAGAATG
CGTCTTTCGACGTTTCGGCGCGAGTGAGGTCATCCGCCATGATCGAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCAG
AAACAGAGAGCTACGATGGCGTACCGGCCGCAAGCCAACGGAACTGCCGAACGAATGGTGCAGACTCTAACGCGATCGCTGAAGATGTACGTGTCGGACG
TGAACCAGAGAGACTGGGACGAGTACGCGGAGCGACTCACGTTCGCTCTAAACACGGCCCAGGATCGAGTTGACACGCCATTCTACTTGGCCCATGGGTG
GGACCCGCGATCGACACTGGAGGCAGCGCTACCGTTAGGCAGCACGCGCCGACGTGATCAGGAGCCCCGTCGATGGAGGTACCACGTACAAGAACACTAC
CAGCGAGCGCGGGAACAGGTTCGTGAGCGACTGCGCGAGGCGATCAGAGGCAGAGCCAACCGACACAACGAAGATCTGCGACCCCACAACATCGCGGTGG
GCGCTCAGGTATGGCTACACCTCGATCGAGTCAAGGAGGGGTATGCACGGAAGCTCGCACACCTGTG