Description :
From Genome Similarity Track
Location :
Scaffold_57:25212- 26604
Sequence
1392 bases(100 bases per row)
AAATGTACGTTGAACTCAAGGTTTTAGAATTTTAATTCTAAAGCCGATTTAATTTGTTATTTGACGACGCGGTTTTCTATGATCGCTGAGGCTTCTACCT
GTGGACATTTAATATTATTTTTTTAGTAAAGTTCGGGGTTTTTCTGGGTCTGTAAAAGCTGGCCACTCGGCATGAACCCAAACCAACTCGAGCAGATGCT
TTCCAGGAAAACTCAAGAGGACAACGGCGTCCAGTCTCTGAACTGTGTGCTGACAGATGCAGTTTACAGTGCAGCCCAGCGAAAGTTGAAGAGCCCACCA
CTGTGGCTCAGTCCGTTGTGAGCGACTTGTCAATGCACTTTGTGCTTCGTGTACTCCATCAAGTGTCTCTTCCAAGGCACAACTTGGCACGCTTTCGCAA
TTGACGACGCCACGCATACAGCGCTCCGATGCCTTGCTCTGTGCGACGCTGGATCAGGCCAACAGGGGTGGCGACAGTTGTCAAAGTATCGTTCGTTGTA
GGGCGAATCCGCCGATAAGGTGCATGAACTCTAATAGTGCCTAACTGCTGAGAGGCGAGCAGTGCCTGCACAACGAACTGGTTGCGCGTGGCAGGCTGGC
AGGCAGTGTGGCTCAGAATTTCGAGGTATGCTGAAGTCAGACTCAACATTTACAGTGTTCTTTAAAGCAGCGTGTTCACCTGATGAATGGTTGGCTGTCC
CAGTTGAAGACTCACTCTCTCAAACACTTTTATTCAAACGGACACGAAGGTCTTCAAGGTCTCTGGATGAGAAACTCAAGAGTGTGTGCTACGCATTCAA
CTGCTGAAATGCTGCCTAGTTTTTCAGCCCAGGATGCTCAGTTGAAAACCCCACTTTTCTCGAACCAGATGGAGACGAAGGTTCTGGTCTGCATCAGTCG
TTTACAATGGCAAGTGGGCCAAGTACACCAACCATCCAACGTATGTGGTCTGGAGACGCTGTGAGCCACTGATTCCACGAAGTAAACGACAGATTGCTTC
TGGACGCGAAGCACGACTCAGCAAAGCGAGAAAGCACCTGGAAACGAGCACCACTCTGTCTGTCGACTTGCTGAGTAGTGACGGAGAACAATGCACCTTG
GTGGCAAGAGACAACCACTCCAGGGCCCTACGCTCGGATTGCTTCACGTCTCCTTAATCACAGCGCGACACTTTCTAGAAAGATAAAGAAGGAATGAGAA
CGCGTGGTGCAATGGACTGTTCAAGCGTTCTTTTATTCATTTTGTATCTGGCCAATCCTTTTTTCTCATTCGCTTCGAGAATGCCATCTCAATGTGTGTT
TCATTAAATCACTTCGCATACACAAACAACGTGTCATAGATCAATGTCCCTACTGAACCTCCAGCGCTCGAAGCGCGACTCAGCAAAGCTGG