Description :
From Genome Similarity Track
Location :
Scaffold_448:25210- 27130
Sequence
1920 bases(100 bases per row)
CAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCTAGATCCA
CGATCTAGGCCCCGGATCCATAAGCTCGAATATTTGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTCCCACTGCTGCTCCACCCCATCC
CCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAA
GTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCC
CGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGGTTAAGTGAAGATTGAGCCAGGGGAAG
AGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTGGGAGGAACTCTGTCGACGGAAGCGAGGTG
GATCCGGATCCGGATCTAGAAGCGAAACCTCTCTATCATCCCCAGGTCCCCTCGGGGGCCCCTGCGGATCTTGACGTGCGTCAAGATCCGCTAACAAAAC
AAAGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAAAAACCAGAAAGAA
GACGAGCACGAGTAAGACTACGCGAAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAG
TTTGTGTATCGCCACCAAACCTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCAAAGATCCAAGGGAGCCCGGTG
AGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACTGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGG
ATATCTTCGAGCTAAACCTGGATCTTATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGTACTATGGATCC
AGTGTCGTCACCGAGGATCAGCCAAGCTGTGTCCTCGAACTACGAATCCGCGGCGGAAGATTGGTCCGACGCGTCGTCCGAGCCCCGACGCATGACTTTA
GAACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGACTCGGGATCCAGTGCGCCCTACCCGTG
ATCGGATACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATCGCCGCACAGATCCTGACTC
GCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAACTGCGATGAGTCGTTTCCTGGCCGAACAAGGT
ATGAGAGCACGCGGGCCGCAAGCGCAAGTGCTCCATGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCG
ACCCAGATGATCTGAATGGTTTATCCCCTCGCCAGCGGCAGTAGCAACAGCTGCAGCCGGGACGGATGGATCGTCTATGATCCAGAGGGTACGGATCTCA
GCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAAGACCGAGCGCGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAG
CGTCGGACGGTGAAAAATGT