Description :
From Genome Similarity Track
Location :
Scaffold_1208:2521- 4726
Sequence
2205 bases(100 bases per row)
CGGGGAAACGAGAAGTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGCCCC
GAAGAGAGCCGTACTCTCTAACACGGAACGTGTATGCAAGTCGGGCTTGCTAGTTGTCCAAGCTTGGGTGAAGGGCTTCACCAAGCCATGGATGATTTTG
ATCGATTCGGGAGCGTCGGGTAACTACGCCCGGCGTTCTATGATGGACGGAAGTCAGCTTTATGCTGAGGCGCTGGTAGCGCGCGGGAGTGACATCGTCA
CTATTCGTCTCGCGACGGGCACTCGTGTCACGGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGT
CTTAGACCTCGATTCGAGACATGATCTCATCCTTGGTATGGCGTGGCTAGAACGCCATGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACG
CACTTCTCTCTTGGCGGAGCATTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACTGGGCCGAGTCGGTCGATGTGC
TGGACATCGGAGTTTCCGAGTTGGTGGACACTGAGTGTGTCGAGAACGAGCGTTCCGAGCGTGGCTCGCGGACGGCAAGTGGAGCGGCACGAATTCCGCT
GAGCGGGTGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCCAGCGACGGCGCGGTCGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGATCGT
GGAGTGGCACGTAATCCACTGAGTGGAGGCTGCGGATCGTACAGCTCTTCGCTGAGTGTCGGTAAAGACACTGGAGCTCCCTCGGAGCTGAACGAGGTGG
TGACACCTGGCGTCAAGACGCACGCGAAATCACGGAGCTCTACAGGGCGGACGGTGTCCATGAAGAGGAGGCAGCGCCGCAAAGCGCTGGCTGCGAGACG
CAAGGCGTCTGCAATCTCACAAGTCGAGAAGGGCGTGTCGAGCGGCGAGGCTCCACGCGAGAGCGAGCAACTCTACACACTCGTGAATGGAGTGACGGGC
GACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCACTGTCTGCTCTCCTGTAGCTGAGCGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGG
CTGGAGACTTGGCCGAGGTAGTGCTCATACGACCCGAAGAAGAGTTGAACTCGTCCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGAAGGCGCT
GAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCGTCGGATCCCATGTATCAAGTGGTAAAGGATTACCAGGACGTGGTCTCGAAGGAGCCGCCCTCG
GGGCTACCTCCGGCTCGAGGTGTTCGACACGAAATCGATCTCGTTCCGGGGACGAAGTACTGCGTGACGAGGCAGTGGCCCTTGCCGAAGGAGCAGTGTG
ACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGAGTAAGTCTCCACACTCTACGCCGACGTTCTGTGTCAGAAAGCCGAA
TGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTGAATGCCGCTACCATTCCGGCACAGACGCCGTTTCCTCGGAAGGATGGTCTTCAGAACAACATG
ACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGGTATTACCAATTGCTCATGAGGACGAGCGACATCCCTCTCACTGCGGTGAGTACTCCGA
GCGGCATGCTCTGGGATTGTTTGGTGATGCCCCAAGGGCTTTCGAACGCGCCAGCGACGTTTAATCGTCTGGTGACGCAGCTCTTCAGGCCCCATCGGGC
GTACGCGCAAACGCACTTCGATGACATCTTTGTCCACAGTCGTGCGGAGCACGGAAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTC
GAATGCATGCGTCAAAACAAGTTGTACACCAACATCTTCGGAGCGGAAGAGATCCCCTTCTTAGGGTGTTTCATCGGGAAGCGTGGCCTGAGGGCCGACC
GGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGAACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGG
GGGAT