Description :
From Genome Similarity Track
Location :
Scaffold_6:2520608- 2521670
Transcript NameFunction/comments
Physo_514809Hypothetical protein

Sequence
1062 bases(100 bases per row)
CCAATAGCGGCATCACCTCTATCAAAAGCACTGACAATATCACCAGAAGCCACGTATTCGTTTTTGATCAGATCGCAACGAACGATGTAGGAACTGGTCG
GGTGAATCTGAGGAATGATGTTCGATAGCTGAGTACTTGCAACAGTAGCTGATGTGGAGGGGTATGTACCCGCTGTGAGACCAACTACTTTACCGAATTC
AGCATTATCGATGATCAGTCGAGGAACGCGAGTAGTAGTCGGCAATCCAGTACCACCAGAGGAGTATAAACCGGAGGTTGGTCTGGTCCATGTTCCACCG
GTAGTTGGTAGAGTTGTAGGCGTAGGAGAGAAATCAAGCTGACAAGCGTAATAGACACTGTTAGCACTCATTTTGATATAGAATACGTTACTCACCGACG
GATCGATGATGCGCCCCAGCATTGACAAGAGCAGTCTGAATACTTCGGTTGATATCGTCATACGAATAAATACCATCAGGGAAGGATACACTGATTGTGG
ATGTAGTTGCAGCGGTAGGTACTTCGATTTTGAACGTTGTGTTCTGAAATTGCATTGAATCAATGTTATACTCACTGTTATACATCGAAATCGATTGAAT
GGCACATACTACATCGCGGAAGTCAGCCGCCGATCCGGGAATGGAGTATTTCCAGGTTGAATTGGTTTCATCTTGTACCAGTTTGGTGCTGTCGAGTTTG
ATAAAGCTGGACATATTGATTATATGTTTGTAGGCATATTTTTGTTTGATAAATTGGAATTAGTCCTCGATACGAATCGGTCTATCGAAGTTATACCTGA
TCTGACCCTTGACCGAATCAATGAAGAGCATTTGGCCTTTTCGCTCCGTGGCTTTGTTGTAATAATAGACGATTGAACGCTCATCTACTCCCTTGATATC
AAAATCTTTCACAACCATCTGGAGGTCTAGCTTAGAATTAGCTTTCAGGATCGCTACGTACTCTGAGTTCAATCTGATCATCTTGTCCGTTGCGAAGTAG
CTGTGGCTCAAGAAGATGGTTGATAGCCTGAAGTGGCGCCCTCTAGTGAAGTAATGTGAGAA