Description :
From Genome Similarity Track
Location :
Scaffold_68:25205- 26546
Sequence
1341 bases(100 bases per row)
CCATGTTGGCGAAAGACAGTAACAGAAAGCAGCAGAGCTGTACCTTCATCATCAACGGCCTCTCGGCACGTGCTGCTAAATGAGCCATCTTGCTCAATCG
GTCTACAAAGATCACTACACCCGTGTTTCCAGCCTTATCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGAGTGCCAGCATCCCTCGGGGACAGGC
AAACTCACCAATGGCGCTGCCGTGCTCGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGCA
CCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCGTGAACCTCATAGAGGATTCGATACTTTAGATCG
TGATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCACCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGC
GCCCAGACAACTCCTTGTCAGAGTCTTTAAACCTTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAA
GTCAGGCACTGACGACATCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGGCCACTACATTAAGTCGCCCCGGCTTGTA
CTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCA
GTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCT
TCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGC
GTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCCGGAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCG
ACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTAATAATGGCCGAGCCATCTCCGCGTAGTTTGCGCTGTACTTGTGCAAGTAATTGGCTAAGC
CTAGCCACTTGCGTAAGTCCTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCTTAAGCCTCGCTTCCCAATGAA
GCACCCGAGGAAAGGTATTTTCTCCGCGCCAAAGACGCACT