Description :
From Genome Similarity Track
Location :
Scaffold_264:25202- 26494
Transcript NameFunction/comments
Phyag_g4090hypothetical protein PHYSODRAFT_353702

Sequence
1292 bases(100 bases per row)
CTCTGTGCAAGCCCTTAACTCAAATCCGTGTCGGATCAAAGCTAAGGACTTGCACAGAAAGCCTCGATGTCGAAGAGGAAAGGAGCCGCGCCAGCATCGA
TCacggcttcatcgccaaaGGCGTGGAgcgacacagcagcagcgtagTCACCGGGCAGCACCGCAACCGGTGCCACACCGATCAACTCACCGTTcagagt
gaagaagatctgATGCTTGTCAGCGTCCAGGCCACACCCAACCGTGAATATGggggcctcctcctccttttgGTTGTCCAACTGAGCCGTCGCGCGGCCC
CACGACGGGCCGAAGGCGCTCCACTCTCCACCGTACGACTTGGCGCCATCGTTGAACACGAAATCGCCGTCATTGCCGTGGTAGGCGTAAGACACGCCCT
TCCAGCCCACGTGCTCTCCAGAGCCGAAGCCGTAGGCGTTCCGGGTCGCTGCGTCGGAGACGGACGCGAGACCCACGCTTCCGGATCCTTTAAGGCCCAC
CTCGTAGTATGAGATGTTCTTTTTGAGGGCGCGTGCGCACGACAGCACGGgcagctgcttggcgccGCGGATCGAGTCCACCGCGCccttgtcgaagttg
cgcaGCATCGAGTTATTCGCCACTTTGTACCTGCCGTCGGGCAAGTAGGTCACGGCACTGCGCGTCGACAGCTCATAAGTGGCATCTAGGCGACGCGCAG
TGCACAGCGCGAGCTGGTCGCTGTAGGGCAGCGTCACGTACGTCTCAGGCAGCATCTTGGCGCGCCACTGACGGCTATAGAGCcccgtcagcagcatctc
cgaGGACGCCACGACGTCGTGGAACGCCGTGCAGACTTGTGCAGCGAGCTgtagctcctccagcgtgagGAATTCGAAGCACAGCTCCAGAGCCGCGAGT
TCTAGCGCCTCACCGTCGCGTGTGTGGCGACGCTTGagacgcagcgccgccaatAAAGTGGCGACCTCTTCCGAGTtctgcgagcgctgcaggtCGCTCC
ATTGGATGTTAACGGTCGTCGGCTGCTGGCTGCGCTTGGTGACAGCGGCGTACGACTCGtaggcgacgcagcagtccTCCGGCTCGAGATCCGACGCGTC
GTccgactcgtcgtcgctgcagttgctggccgtggagcacgagctgctgctgatgctgtagCGGCGGCGCGAGAGGCGGCCTTTGGACGGTTTCTTGGTG
AGCACCACGAACGAGTTGAGGTGCGGCAGCCGCGACGACATGGCGGGGACGGtcggcgacggcagcgaggacgacaagAGGGACAGCATGGC