Description :
From Genome Similarity Track
Location :
Scaffold_735:2520- 10069
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_735-fgenesh-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_735-fgenesh-gene-0.0Nucleolar GTP-binding protein 2
Pytiw_DAOMBR242034maker-piw_contig_735-fgenesh-gene-0.1Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_735-fgenesh-gene-0.4Inositol-3,4-bisphosphate 4-phosphatase

Sequence
7549 bases(100 bases per row)
GACAGCGAAGTTTATCTGAAGCAAAGCATACCAACAAAAATGAGAAGGCTGACCGTGTTCTCGCCTGCCATTAGTATCGAAATGAAACAAGGTCGGAACC
TTTGATCAGTTGAGAGCCGTCAACACGAGTCATGATCTAGCAAGATCATACAGTTAGCTTTACGCACCTCTTTCGCCAAGCCTTCATTACCCATTTCGCC
TTGAGTCGACCACTATCGTCCAGCCTTCGACGACTTGCGCTCATATAAGGATGGCGCGAGCGTCAGCGGGTACAAACTTGCGTGCATTTCGAGTTCACAT
CGACAGCAATAAGGTGATCGATGCTGCGGCGTTCAAAGGCGCTCTCCAAGATATCCTGGGTGTCGAGCAGCGCAGCGGCTTGAGCTTCGTCAGTATGAGG
ACTTCGATGAACGAGCTCCAAGTTCTCCGCCTGCAGGTTAATACCATGAGTCCGAAGAGCTTGGCGTGCATCTTTTCGGCGCTGCCGTACACGCAGGCGA
TCCACACACTCGCGATCGAATGCGGTGGGAATGATATCTGGAACCTGGGGCCGCTAGAGATCAGCTGGCTCGCCTATGCGCTCTTCCATCCGCGCACCAA
GACATCGAGTTGGAAGAAGCTCACTGTGGAGTACTGCGACATCGCTGACAACGCTGTGGAAGTGCTCGAACAGATGGGAGAGGGTGACAAGGCCCCATTG
CGCTCTGCTACCTCGCTAGCGAAGCTGATGGGAGTGCACCAGTTGGAGAAGAAGCGCAAGCGAGGAGAGGAGTCAGCAGCAGCAGCCCTTCATATCCAGA
TCGGAGACCAGCTGCAGCTCCGTCTTNNNNNNNNNNAAGAGTCAAGCGTGGCGCGGCCGTATATACCCACCCCAGCGATCGCGATAGCTCGAGCGTCGTG
TTATGCACTGTTGCGAGCGAGATGGAGCTCGAGATCTGCGAGCTCACTACTGAAGCGTGCCGGTGCGTCCTCGTTCCTGGCTTTGGCTTTGGTTGGGTCC
ACCACGAAGAGCTCCTCGAAGTGAACACCTGGTCGGTGGATCCTGAGCACCTAACTGGTTTGTCGCCGCTGACCACGCTTCATGTTGATTCACCAATCTC
CGTGATGAAGCTATCGTTACTCTTGGCTGCAGTAGGCCAGTCGCTGTCGTCGCTGGCCGTGAAAATATCCAACTCGCTCAGCGCGGTCTTGGATTACATC
CCCTGGTCATGCCCGAACCTGACGGCACTCTCCATCTATGGTAATCACCGATTGAGTCTCGATCAGTCGATCCGACGGTTCTTCTTGCTGCCGTCGACGC
GAAAGCTCCGCACTTTCACTACAGACACACGCGTTTGCGATCCGGATGCGCTGGTGTCGATCCTGGGTGACCCAGTCACAGAGACGCTTCAAGAGCTCCG
TGTCTTCGACAGAGACATCTATCGCTCGAAAATGTCCCATTTTGTCAATCTACTGAGCTGCAACACGACGATTGAGCGCTTCATCTTTCGCAACTGCACC
GGGGTGTCAAACGCTTCGCTCGAGCTCTTCGACGGGGAAATCTTGCAATCGGAGCGAACCACGCAGCGCTTTGTGGCGTTCCTTAGTGTCGTGGCGCGTA
GCACGTCGACTGGCGCTGATGGTGGAGCTGAAAGTAGCGCGGTGAGCAGACTCGCGGACCAGAATCTGCTCACGATTATTTTCAGCTTCGCGGGAGTGTG
CCGCGTTGTCGTCAAGTGTGTGAGTCGTCGCCCGTTCTTGTGTGTGTAGTGCGTACTTGGCAGTTGTGCACCCAGGCTTCACATTGTGTCGCTGCAGTCA
ACGTCTTGCGTTGGGCGTGCTCGTCTGCTGCTTGGATTTTCGCGCGGGCTTGAAGCTGAAGTGAAAGGGCGGGGCTGAACCTTCATCACTCTCAAAATTG
ATTCTAATTAACTCCCCACGTTTCACTTTTCACAGTTGGAATTGCTTTGAAAATGGTGATGAACTCGAGTGACGCACGGCAATCATAATCCAAGCTCAGC
ACAGCCTTCCGAGCGAGCACCACCAAAGTAAGGGCGCTTGAGCTCTCGTCTCCGGTACGTGCGTGAGATCGCACAGCCCATTAATAATAAAAACTCCCAT
GTATTCTCCTCGGAAAGCTGACGTAACGCCATACATCTCAATAAAAACAAGCAGCTCCGTAACGTGCCTCAGTCCATGGACGCCACGACCGCACCGAGCG
CCGCCGACGACGCCTTGAAGGTCGTGTAGATCGTTGCCTTGGCGGCTTTGAGTGCTGGGAAGCTGAAGGTTCTGGCGACGGTCACGTACGGCCGCAACAC
CTCGCCGCACGACTGGCCGATGGGCGTGTTACTCACGAACTCAAAAGGCTCGGCGATGCACGAGACGTACAACCGGTCCAACAGACTGTTGCGGTGCGCG
ACAAAGACGTTGTTCCGGTGCAGACGGATCGCAGCTTCAAAGCCCGACTTGGTCACGTAGGAGCAGAGCAGATAGTTGCCGCTGATCTTCTTCACGCGCA
TCTCGAGCTCATCGATCGGCGCCAGCAGCGCAGAAGGGTATGCGCCGAAGCCCTCCATCTTGACGACGTCGCCAATCTGAGGCTCCATGCCATGCGGCTC
GTAGTGGAGCACAATGCGGACTTCGCCCAGCGCCATCTCCTTCTCAGTCGCGCGCTGCTGCTGTTTCTTGCCACCGGGGGCGTTGTGACTCGACGCGCCT
GTCGAAGCTGGGATGCCGCCCGTGAGCGTGATCCAGCGGTCCATCACGCCCTCTTTGCCTTCAAGCAGCGGCGTAAAGTCCACGACCGCAGTGCCGATCA
CAGAGCCGTTCGCCATACCGACGTACTCGGTGGTCTTGCCCGTGAGCGAGTCCTCGTTCATGACGTCCACGATGAGCTCGAGACGCACGTCCGAGTGGTC
CTCGAGCGGCGCGCGCTTCTGGTCGTTCTTGGGGATCTTCATCTCGATCATTTCGCGCCGCCAGGACGGGTTGTCGTTCGCGAGGATCGTCGAGCTGCGC
GCGTTCATCTTGCCCACGCGGAAGATCACGTACGGGTTGCACGTGCGCACGAAGAACATGGACGAGGCTGCGCGCAGGTTGCGCGCCTCCACGAGCCGGA
TCGAGAGCGTGCCGGCGAGTCCGTCCTGGTGGCTCAGGTGCTTCTCGTACTGGAATGGCTCCAGGTGCGTGCGGTCCGCGGGCGTCACGACCAGCGCCAT
CTTGTGTGCTCTCGCGCTGTGGCTTAACTTGTTCGAATGTGAGAACGTTGTGTGACGCTGCGCGGACGAAGGGGCTAGATTGTGAAAATGCAGATCAGAA
GCAGGTCTGTATTGTGAAATACATTGTATCAGTGCTGTCTATAACTGTAATAAGTGGCTCTCAAATTGCAAGCTAGCGAGATGATTGGATGAAAAAATAG
ACATTATCAGGAGAGAGCGTCAGGATTGGCTGAAATGCCGCGATAGAAGCTGCCACCACCCATTTAGCCCCAGTTGCCTGTTCCAATACCTTGGCGAACA
GCTCTTTGAGTGTCAAACGACAGGAAGGAAGCAGAGCAGGAGACCTACGACTCCGCTTGTGCGTCTGCCTGTTACATCACCACCACAGCCACAGCCTCAT
CGCCCCAACCACCACTAGACACCACCACCACCAGACAGTGACCATGGGCAAGGGAATCAACACGACCAAGGCGAGCGCCGACAACCCGAACCGGACGGTG
CCCAAGCGCCAGAAGGCCGCCAACATGCGCGACAAGGCCACGATCAACCGCCTCAACATGTACCGCAACAGCGGCGCGATCCGCAACAAGAAGGGCAAGA
TCGTCGGCGGATCGCTTATGATGGGCAACAAGCAGGGCGGCCAGGAGATGGCGGCCGGCTCGGCGCGCATCCAGCCGGACCGCCGCTGGTTCGGCAACAC
GCGCGTCGTGGGCCAGAAGGAGCTCGACAAGTTCCGCAACGAGATGTCGATCAAGGCCGCTGACCCGTACTCGGTCGTGCTGCGCTCGCGCAAGCTGCCC
ATGGGCCTGCTGCAGGACTCGGAGAAGGTCACGCGCATGAAGCTGCTCGAGACTGAGAGCTTCGAGGACGTGTTCAACGGCAAGCGCACGCGCAAGCGCG
CCAAGATCGCCGCGAACGACTACTCTGCGCTCCTGGAGCGCGCGCAGACCGGCGCGGACTCGTACGAGGCGAAGGGCAGCGACCGCAACATTCACGTGGA
GCAGGACTTCAAGGTCGAGGTCTCGCACGACGTGTTCAGCAAGGGCCAGTCGAAGCGCATCTGGGGCGAGCTCTACAAGGTGCTCGATTGCTCGGACGTC
GTGATCCAGGTGCTCGACGCGCGCAACGTGCCGGGCACGCGCTGCGAGCACGTCGAGAAGCACATCCGCAAGAACGCGGCACACAAGCACCTGATCTTCG
TGATCAACAAGTGCGACCTCGTGCCCAACTGGGTCACCAAGAAGTGGGTGCAGAAGCTCAGTGAGACGACGCCGACGCTGGCGTTCCACGCGAGCATGAA
CAACCCGTTCGGCAAGGGCGCGCTCATCAACCTGCTGCGCCAGTTCGCCAAGCTTCACCAGGACAAAAAGCAGATCTCGGTCGGCCTCATCGGGTACCCG
AACGTCGGCAAGAGCTCCGTCATCAACGCGCTCCGCAAGAAGCGCGTGTGCAAGGTCGCGCCCATCCCCGGTGAGACGAAGGTCTGGCAATACATCACGC
TCATGCGCCGCATCTTCCTCATCGACTGCCCCGGCATCGTGTACGACCAGGGCGACGACGAGGTCGAGACGGTGCTCAAGGGCGTCGTGCGCGCCGAGAA
GCTCCCGGCGCCGGCCGAGTTCATCCCGGCGATCCTCGACCGCGTCAAGAAGGAGTACCTGACCAAGGTGTACCACATCGAGAGCTGGAAGGACGAGTGG
GACTTCCTCGAGCAGCTCGCGATCAAGTGCGGTAAGCTGCTGCCAAAGGGCGAGCCGGACTTCAACAACGTGGCCGTGCAGATGATCAATGACTACCAGC
GCGGCAAGCTGCCGTGGTTTGTGGCGCCGCCCATGAAGCCCGAAGAGATCGAGGCCGCCGCGAACGACGAGACGCCGCTGAACGAGGCTGTGGGCGTCGA
GGACGAGGTTGAAGAGGAGGACGACGAGGACGTGGACGACGAGGAGGAAGAGAAGGCCGCTGCGGATGAGGATGACGAAGAGGAGGAGAAGGCAAATTAG
AGACTGAAGAGCGAGCAGCGTAGACGTGCATTTCTTTTTGCTTTTTTTTCTATTATCAAGTTTATAAATTGGTTGCATTGTGATACGACGCTCGACGCTT
CCCAGCAGAGCGCTGGGTATGAAGAGCTCAATGGAACTCAAGACACAAGTGCAGAGCAATGCCAAAAAGCGTGGTGAGCTCTCTGCGATCGCGCGGCTGC
AGTTGGCGATGGAGCGCCATGCAGCTCTCGAGGGCGACGCTTCCGCCATGTTGAAGCCACGAATTTCGACGGCCAAGGAGACATCGGCGGCAACGTTGTC
TGCTGCGCAACAGTCCAATCAGGATCACCAGGTGTCGAGCAAGCCAGCAGCAGTGAGAGCGAAGACAACCAACTCTGTTGCAGCCCTCGCTGAGCAGCTA
CAGAGCTTGAGGCACGAGCCAAGCGATGCGAGCGACCCTCAGCGGCGAAGAGCTACGGTTGATACCATGAGCGCCAGTAACGACACAGCCGAGAGCGAAG
ATGAGATACCTGCTGCTGCCTCCAGCGTGCGTCAACAATATCGACAGCAGCATGTAGCCTCAACTGTAAGTTCTTCATCACCATCGCCGCCGCTGGCGAA
TGCGCTGCTGAAGATCGGGTCGCACGAGAAGGACGAGCTGCTCGTGCACTTGCTGCAGCAAGTGGCGTTCTTCCGAGGGCAACTGAGCGAAGTCGCGACC
CTGGGCGAGACGATCGCTTCTCAACTCGTGCTCCAGCAGGTATGTTCGCTAGTGGACCCTGAGCTGCTGGGATACAGTATCTGATGCGAACTCTGTGAGT
ACTTGTCGCCAGCACGAGCTTCGCCTGAAGCATCGAGAGCAGATGACGAGTCTTGAGCAGCAGCTGCACGATGCAATGCACTTCCACCCATGGGTCTTGG
GCTTGGAGCGCAAGGTCGAGGCGCTCGAGGCCAGCAACCGGGAGAAAGATCAGCAGCTTCGCTTTGCTGTACGTGTTGTTTGTTGGCCTGGTCTGATAGC
TTGGAGGGACGATGACAGTGGAACTTGGATGTTCGTAATGGCGGCCAGGTCCAGAAGCTGCAGCGCAGTCGACAACGCGAGAAGGAGCTCAAGACGATGC
AGGATCCGCTGTGGGACATCTGACAAAATCGGCTTCGTTAACTGTACAGTTAGTGACTTCTTTAGCCGCCAGAGTGGGAACAAAGGGAACAGAAGCTATA
TACACCTTAAGGAGGAAATGTATACACTCACATGGGGTTGAACACCGCATTTACGAGGCCACATGCGCGTCGGCGGCGGCCATAGGCGGCTTGTAGCACT
CGGGGATGTACTTGAGCTGGAACGAGTTGAACGCGTACTTGTCCTTGCCCGTGTTGGCCAGTACGTTGACGCGCCGCACGCCGCGCTCGCGCATGGCCGC
GCACAGGTGCACGCCCTGCTTGACGTGGAAGGTATCCACGAGCAGCTGTGAGCTCTCGAGCGTCACGGACATAGCCGTGCGGTCCTTGCCGCTCTTGCAG
CACGTCGTGCGGCCGGCGCCCAGCTGGCGACAGAACTCGCTCGTCTCCAGCAAGATGTTGACGTTCTTCTTCTGCACGTGCGCTTTGACGGACACGTTGA
GTTTCTCGATGAGGATCGCGAGCTGCGTGCCCAGGTCCGGCAGCTGCGCCAGCCGCGCCTCGTTGAAGTCCGAACCAGTGTTGTGACGCGCGTGGTACTT
GACGAAGGCCTGGTAGACGCGGAAATAGCGCTCGAGCGCCTGGATGCTCTCGTAGTTGATCTCGTCCTGCAGACTCGTGTCCATGACCGTGTTGGCCACC
GACTGCATCTCGTTAATGCCCTGCGTAAACATCACGGCGTGGAGCTTCACGCAGTCGCCCTGCCTTAGGCCCTCGGGCAGCGCCGCGAAGACCTCGGATG
GCAGTGCGAACGTCGCCACCACCTGCGAACCCTGCTGCTCCATGATCGACACACCAACGCACTTGGCGTACTTAAGTGGCGAGCGCTTCTTCAGACTCGG
GCGGCCCACGACCGCCTCCGTCACCTGCACACTCACAGACGAGCTGAGCCACTTGACGCCCTCGACCATGTCTTCGATCATCCCCTTCTCGCTGCGCAAA
GTGCTCAGCAACGACTCGATACTAATGAGGAACCCCGTGGAGCAGATGAGCTTGAGACGGTCCATGTGGATGGGCGACTTGTTGCTCGCGGCGAGCCCCA
CGACGGTCAGGAACGCAGCCGATGCCACCGACAGCACTTGGCTGCGTACCACGTCCTGGCGCTGCTCGATCTTCTCCAGCAGCCGCTCATTGTCTTTGGG
AGACAGCGCGTAAGTGTGCAGCATCTTGCGCAGACCGCCCTCTTTGAAG