Description :
From Genome Similarity Track
Location :
Scaffold_1080:252- 7656
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1080-fgenesh-gene-0.0Mediator complex subunit 4
Pytir_DAOMBR486maker-pir_contig_1080-snap-gene-0.4Protein phosphatase 2C
Pytir_DAOMBR486maker-pir_contig_1080-fgenesh-gene-0.2GPI ethanolamine phosphate transferase

Sequence
7404 bases(100 bases per row)
TAGTCACAATGGAATCAAAGCACATAAAAACCATTAGAAGCAGCACATGTAAATATTTGAAGCAAATAGAGCAACCGCACCAGCACTACACGCGTCCTGT
CACTCACATCTCACTGCCTGCGAGCCCGTATCATTGCTTGCTTGCTGGACTATCACATTCACAACGCTATAACATTTGCGGTGGCTGTCGTGTCGGCGCT
CCACTGAAATTTACGCAGGCATTGTCCGCGGTGTCGCTTGCGGCGCTTCCGCTCACGTGTCAGCGAGCGCTAGGAACCACGCCGCGCACTTCAAGCCGCG
AGCAGCGCGCGGATGGACACGAGCAAGCGGCTGGTACTTGAGAAAAAGACAGCACAACAGCATATTAGATACAGACAACAAATAGATCAAAATCCTCGCC
AGAGAGGTGCGCGTGTACCGGCTCACCGGCAGTGTGAGCGCGAGCTTTCACGGAGCTTGTTTGACTTGCCCATGACACCAATATCAGCTCGAGTCTTGCT
CTGCGAAAACAAAATTCGCGCAGATAGTCACACTTCAGCTGTCGACACATTTATCTTCGCCACGCAGACTTGTTTATACAGGCACCATTCTCATTACTAA
CCACCTCAAAAATGAGATACCCTCTCAAAAACGATACTCGTCATTCAAAAAGCTGTACTAAAAAAGTGGCGCGTTTTTAGTGCGCGGTTGCGAGCTCTTT
CCACCAGTGCTGAACCGACGAGAAACAAGACAAACAACACGCAGCAAGAATGCCATCCAGGACCATGCGCGTTCAGCTGTCGGCGGGGCAGAAGATGACG
CTGTGCAGGCACTGCAGCGCGCACCCAGAACTGTCACTGCGTGCACTTGCTGCGTGGGCTGGCAAGGAGTNNNNNNNNNNCGAGTTTCAGAAACCTCCTT
CGCATGCGGCCGTGCTCGCGATAATAAGGCACCCGGTGACCGAGGAAGACGCCCTCTCAAAGCCTGCTCTCAAGACCAATCAGCGCGTGAGCTGTCTGAA
TTTGGAAAAAGAGCTCGTTCGCTGGATCGAGCGCTGTGAGGAGCTGAAGATACCTGTTGCGACGTGGGCAACTATTCGCGTGAAGGCTGAGAAGATCCGC
CGCGCGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGAAGCAGCCTT
AGCTTACATCGCCGACGTCGAACAAGGGCACACGACACTGCAGCACGTCACGTGCAAGTACGACCTGCGCGACATCTTCAATATGGACGAGTCGGCCCTA
TTCTACTGCGCGCCGCCGTCAACATCCGCCTCGCGTTCAAGCATCGCTGGACGAAAGAAAATCAAGAAACGACTGACCGTCGCGATCACTACAAACGCAG
ACAGCTCGTCCAAGGTACCGCTGTTCTTTGTGGGCACGACGCGGCGGCCTTGATGCTTTGGTGGGCGCGCAGCAGCAGAACTCGGCATCAGCTACACGAA
TGCAGCCAAGGGCTGGATAACTGCGCATCTTTTTTGCAACTGGCTATCAGATTCTAACGACGCAACGCGCAACGAGCAACGACACGTGCTTCTTTTGCTC
GACAACGCGTCTCCGTATTGAGTGAGCGAGAGCTACTCAAACGTCGTGCTCCATTTCCTCCCTCCAAACACCACTGCCCACCTACAGCCGCAGGACGCCG
GCGTAATCCAGTCTTTCAAGAGCCAGTTCAACAAGATTAGAAACGAAGAGGTGGTGGAGAAGCTTGACGAGATGTTGGACCAAGTGGGTAACGATGGCGA
AGGGCACTTAGAAAAGAGCGCGTCGAGCAGCTATACAACGTTAACATCTTAGCGGCAATGAAGTGGGCAGCGAAAGCGTGGGACGCGGTGTCGTGCGACG
CGATTGCCAATTGTTGGCGCCACACGAGGATTATCGCGGCGGATTTTCATGAGTTTGTCGGTGCCATGGACAAGCTTCGCATTGAGCCGCCTTCTATCTG
TCAGCTCACGCAATAAAACCTCTACATTTTAATTTCGATATATTTTTATTCCCTGTGAGAATGTATATTTTTTAGACCCCAAATCGCTGGTTACTAATGA
GAATGGTGCCTGTACCTGGAGTAGTGCGTCTCCTGACAAACGCACACGCTACTACTGCACGCGCACGACACCATTACACGCACACCGATCCATCTGGCGA
AGGAAACCACACAATGACAAACTAGAGCCAGCGACGACAAACTGATCTGCTGTTGTACTTTGGCCACATACCACAACGCTACCGTACCAGATAGGAATAT
GTGCGCCTCTCCGCTTCTGTCGGCAGACACCAGCGACTGACACCGCTCTTTTGTGTCGGTTGGAGCCATTGCCAGTTTGATCATCGTTTTTCACAATTTA
GAGGGCAGTTGGCTTGGGCGGCTTTGAAATCGTTTGGCTGTGGTTTGATGGATTTGCACTTGCGGTTAGGTGTGAAAATGAGACTGCAGTTGGGAAATAA
ATAATTCGCTGTGCACGAATAAGCGTGCCACTTCGCACGACAAAATGTCTGCAAGGCACAATACTGATTAATTGCATAAACGCTGTAGATGCATGAAAAG
AGTCCTCGTAATGTGGGGGGTGCAATTGTACCCCCATCACTATTTGCTGTTTACTTCTCAACAGCACATTAGCGCCAAAAAGGCCCCACAAGCTCAAGGG
CGGCCATTTCGTTCGCTCTCTCTGTGTCTCTGTATCTGTGCGGACGCGTGAAGCCCAGACGCAGAAGCGAAAGAATGCCGAGCGTGCGTGATGACGTGGA
GATCTCTCTCCACGAGCACCGCTTCCTGGTCACCAAGCTGCTCGAGTCGCTCAGCACAGCCTCGCTGTACGTCTGTCACACACTCTCTCCACTTGCGTGA
CGCCTGAACGATAGCAAGCTGACCGACCACTAACACCTCTCTTTCTCTCTTATGTGTATATATATATATGACGGTCACTATCAACGCCACCTGTCGGTCT
GTAGTCCGCCGTCGACGATCACTGCGACACGCCTGCGCACCGTGAACGAGACGTTCGGTAAGGCGCTCGAGAAGGATCGCGAACTGCTTGCCGCCGTCAA
GAAGCGTACGTCATGCGTATGAGGCTCTCTCTCTCTCTTTATCGGAGACGGAGATTCTGTGTGTGTATGTACTTGTAATAGACGAGTGGGCTAACCACTG
TGATTCGTATATGTGGTTAGTGGCTCGCCACCAGATCGCGCAGAAAGAGCTCGCGGCCATCCGGGACGAGATCCAGAAGAAGAAGCAGAAAGTGATCCGC
TACGCCGTGCAGCTGCGCCGCTCCCAGGAGGTATACCACTTGTTGATTGTTGTTGTTGTATGAGAGACTGATCTTTCAGTACATGCGTTCTGGGGCTCTT
ACATTGTTATTTCTATGGGCACATACTTTAGGACATTGCGAGCGTGCTTAAGAGACACCAGACCGTGCTCGACCATGCCAAGCAAAAAACCAAAGGTACG
CTTGCGCTCAGCATGTCTATGTATTGTTCAATAGATATGCGATGCTAACTGTGTTGGTACTGCTATACTATATATTTTGTCCACAGTTGTCTTGGACCCG
CGGGACATCGTCGCGTACGCGCACCGCATTGCTGGCACAACCTCTGCTCCGCGAGAGTGGCGTCCTGGGGTGCGTTGATTGGCATCCATTATGCAATGTT
CTCCTACTGTTGTTGACTGTGCTCACCTGGGTGGTCCTTGTTTCTCCATCTGATTTAGTTTCCCATGTTTGGCTTCATGCCGCCCGCGCCGCAAGGTCAC
ATGATGCGCGCCGGCGTGCTCAGTCGCGGCATCGTAGATGAGATCGTGACCCAGGAGCCCGAGAAGTACTCGTCGACTGCGAGCAAAGTCAAGAAAGACA
GCGACGACGACCTTGACAAGCTCAACATCCCCATCGGACTCGGCGCGAGTGATGCACAGATCCGAAAGCAGATGCCACCAGGATGGAAGCCCGGCGACCC
GGTCGACCTGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATGGGGCGGAGCTTCTTCGCGGTACTTCTTGTCGTCCATATCCATGATG
TTTACCTTTCTCTATTGTGATCTAAACAGAGTCGTGGCGTTGTCTTCATACTCTATAGGAGCAAGGCATTACATTATCCGAGTCCTGGAAAGCCGGCGAC
CCGCTGCCGCCCGACGCGATGGAGATCCTGCGTAAGAAGTTCAAGTTCCCCGAGAAGCGCACGCCGCTCTACGACGACGAGGTCGTGGACGACGTCGAGA
GTCTGCGCAAGAAGCGCAAGCTCGGAGACTCGTCGTCGGACGAAGCAGACGAAAGCGGGACTGCGACGGGCAACGAGACCGGATCCGGCAAAGACGACGA
CGACAGTGATAGCGACAGTGACAGCAGTGACAGCGACTCGGACAAGGAGACGACACAGAAGATCTCGCTCAGTCTCTCCTCGGACGACGACAGCGACGAC
GACAGCGATTAGGCAGGTGCTGCGGCTGGCGGGAAATGCGACGGAAGAGTTAACATCCGATGCAGCAAAGAAGCTCTTTTCTTCATCTAAGAATGAACAA
AGCAATCCCAGGACGGTATGTCGTTGCTCTGTCAACTTACATAGTGAAACGGCTAGTTTTTGTTATGTCATACAGGTCCCACTTTGATTTGCGAAGACGA
GTTCGAGACACGGAAGACTCAAGAGCGATGAAATGACGGAGGGAAGTCAATGTCGTGACAATGCTAGACGATCCCTCAAGTGCGAGTTCGATCAGGTACG
CTCTCTCTTGGTATATGCCCGTCAACTTGACGACAGCATCTCATCGTTGGTCGCGATCAAAAAAGTTCCACCACGAGTGGACCGTATCAAGGAAAGCAAC
TGGAACAGACAAGAAACTGCTTAGTTGCGGGACAGAAGACACGATCTCTTAGGCAGATCTGAGCGTCAGAAGATGTGCTGTTTTCACATATATTGTGGAT
CCCCGCGGCGGCGGAACGAGGTGAGATTTTGATTCGCGTGGCTCTGTATACATAAGCAGTGGGTTCGCTTCTCAAGCCCAGCGCTATTCCGTTTCCGCTT
TCGTCCGTTGCAGTTCTGACTGCCGGGCTGCTTGATGGGTTTCTCCTCCTCTTGGGCGGAGAGCTTGCCACAGACGAGATCCAGGACCGAGAGCCAAGAC
CGATCGACTTATACTTAGACTTTTGCTCAAGAGCCTTGCACACTTCGCCGTCTGATCACGGCCTGATAGGGACGTGAAGGTGTGTGCTCCGATCGCATTT
TCTTCTGTCAGCGCCAGCCAGTTGAGCTACTCGCCTCAGAAAGCAAGCGCTCGTCTTATTTGGTCTCGCTCGAATCGTAAAGCGACCGCAAAAATAGCCA
ACAGTGAGGTGGGAAGAACTGCGACGAAGCAAAGGCGAAGCGAGTGAGCGCGTTTTCCGTGCCGTGAAGCTCACATTAACAGCGCTCTCCTCTCATTTCC
GCATTTGCACTCGTCACCACCCCCAGTCCAGCGTCGTGTCTCAGTCTCCCTTCTTCAAGCACCGTCTCCCAAGCCAATCTTCTCCTCCTCCTGTCTCGCA
GAATAACGATGGCATTGCGTCAAGGCGTCGCGAAGAATGGCTCGGTCGCCAAGATCCGTCAGCAGGAAGCCGCGACAGCCGTGAATGTGGCGTCGCCGAA
AGGAATCTCGAAGAAGACCCCGGGCATCTCGCCGTCGAAGGCCGGCGTCAGCGACCACACGCTCGGGCTGCAGCGCCGAAGACTCTCGGTCGTGAGCGAC
AACAAGCTCGTCGAGGGCATGGCGCAGGTGTCCACCACCGATGCGGATTACGTGGAGGACGGCACGAGCGCAGTCGCCGCCTACGCAGGGCTCTCGAAGA
AGGGCTACGCGCCGTACAACCCGCGCAAGAAGAACCAGGACTCGATGATCATCAAGCACGACCCGGACTCGCGATCGCTCTTGCTCTGTGTGTTTGACGG
CCATGGTGAAGCTGGCGATGGTGTCTCGAACAGCATTCGCGACAAGTACCCAGACGAGCTCTTCAAGCACCCGAAGTTTGCTGCCTCTGGTGATTTGACG
GCTGACGCCACGAATATGAAAGTGGCGATCGGTGAGTCGCTGCAAGCCGTCGAGAGGAACGTGATCCGTGACCCAGCGATCGACACCGAGTTCAGCGGTA
CGACCGCTGTGGTGTCGGTGATCCGAGAGAACCTGCTGGTCGTCGGCAATGTCGGCGACTCGAGAATCACGCGCGGGTACGTCACGACGTCCCCGAATGG
CGAGGAAATGCTCGCGACCGAGTCCGTGTCGATCGACCACAAGCCTGACCGTGCCGACGAAAAAGCGCGTATCCTCGCGAGTGGCGGCCGCGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCATTGACGGTCCTCCGCGCGTCTGGCTCGGCCACATGGACGTCCCAGGGCTCGCCATGTCTCGCTCACTTGGTGACG
CGGTCGCACACACGGCAGGTGTGGTGTCTGAGCCTGAGTACTTCACGCACATGCTGGACGACAGCGATCGGTGCCTCGTAATCGCGACCGACGGGCTCTG
GGAGTTCATGTCAAACGAGGAAGTGATCGACATTGTGATGGCGCAGAAGGACCCAAAAGTCGCGGTAGACCTGCTCATCATGGAGGCGAACCGCCGCTGG
ATGAAGGAGGAGCAGGTCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGAGATGGCGCCGGTCGGCGCTGTCGGTATGATGGGCGGC
AATGCCGGCGCGAGGGGTGAAGCAGCAGAAGCCACCGCTTGAGAACGAATGGCATGGAGCTGATAGAACCTGCCACCGAACGAACGCTTCTTGCTATATT
ATATATAAGACCACCACCATCCTCATCAATATAAAGGCATTCCCAATGACACAAACCGTAAGAGGTGCTCAAAGTCTTGCTCTCTATTGCGCCTTCTTTC
GCAGCGACTCACTATTATCGGAGGATACCAGATCCCACACAAACGCCTTCGCGAGCAGGAAGAGCAATGGCACGAACACGATGAGCGCGTTCACGATGCC
GAACATCGAAATGGAGTTGCCGATCTCCTTCCAGCTGCCTTCGTTCTTGACGAGGAACAGGAAGTGCAGCGCTAGGAAGTCCGACATGCCCACGACCAGC
AGGAAGTACCGCGACGGAGGGTGGCGCATGATGGGCGAAGACGTAGAGCTGCTATTATCGCCCATTGCCTGGTTCTGGCTGAGCTCCAGCACGATGTGGA
ACGCGCAGGCGACGACCATGAACGGAATCAGGATCTTGATCACGAGCAGCGCACCCATGAGGAACGGCGAGAACACAGTCACGAAGCGGTACGTGGACGA
GATC