Description :
From Genome Similarity Track
Location :
Scaffold_1124:252- 5626
Sequence
5374 bases(100 bases per row)
TGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAA
AGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGAC
TGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATCTGGGTTG
GAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGATAACGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGA
GATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACAACTTGGATCGAGCCCGGGGAGACCTGG
GAACTTCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTCGATCAC
GATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTGTTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACC
TGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCG
GCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATTCTGCAGAGGGATCGACGGGTCGAGATCCAAGCAATGGAGGTTG
GATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGATTAAAGCCGAACAGCCCCATCCCGC
TGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGCTTAAACTCG
CTAGAGGACCGACTAGATCCAACTGTTGGTTTCCCTGATACCAGGGTACCTGATTCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGCCGCGGTGTT
TGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGT
GATCCCGGAGGTACCACTAACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTATGCGTCAG
AAAATTTGGGAGAGCCGACGTCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAAC
CGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAAC
GTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGATTAACGGTCTGACTCGATTG
ATGGTGTACCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTA
CTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGAT
CTACCAACGTCTAATCGAAAACGCTCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTT
GAGGCAGGAGAGCCAATGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGT
GCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGG
CCTAAGGACCTGTCTTCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCG
AGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCT
GGCCCGAGAGATATCGGATCCACAAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCTGGGACCAACAGAGAGAG
GATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGATCAGGATCG
CGACCACGCCTATCCTCCGTCATTTCGATCCAGACGTCATCTACGGGTATAGTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAGAACATGAG
GGGATCTGTCATTCAGTCACTTCGTCAGCCGGACACTGAGGCCGAATGAACTGAGCTACGGAGCAGTGGAGAAAAGAGATACTCGCGCTCCTGCGCGTGT
TGGATCTGAAATTACAACCTGTTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGAGTTACAAGGAC
GTTTGGGACAGTGGACAGCTTTACTCTCGCCTTAAACACTGGATATTCGAAAGAAGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGA
GCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGATGAGGATTTGT
ACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTATAGTGCAATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAG
ATCCACTTATGCGGAAGGCCTCACCGTCCCAGCGCGGTGTTTAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGA
TTTGTGGGGATTCAAATTTAGTGATCAGACAGGTGCGAGGTGAGATTGACAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAATGATGATCCACCTGCG
TGGTTGGATGAATCACGAGTTGGTGTATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAA
GTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCG
TCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTTGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGA
GGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGGGATCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTAC
GCGGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTAC
AACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAGCGAATCCGGGAATGTTTTCACTGGAGGGG
ACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAA
GCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTA
CCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGCGAAAT
GATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATTTCGTCCC
CAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTTAAATGAGTACGCAG
AACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATGCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTGGAAGC
GGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAAC
GAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCATCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGG
ATCGAGTGAAAGAAAGGTACGCCCGCAAATTGGCCCATCTATGGCACGGGCCGTTCCGGACAAGCGAAAAGATAGGGGAACATGCGGTGAAGTTGGAAAC
GGCAGGTACCGAATATCGTTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGCTGGTCAAGGAATATCCGGACCGGCCGCAAATCCGTATTTCGGTGGAT
GAGCCCAACCGGGTATATTTCGACGAAGTCCTCCTACCGGAAGATAGCTGGAATGTGGATCTCGAAGCCGACGAGCTCGAAGTCGAGAGGATCACCGATA
TGAGGTCAGGGAAACGAACTAGATACGGACGGATTTACCGTGAATTTCTAGTGTATTGGCGCGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCT
GAACTGTGGAGCATTACTCTATGATTGCTTGCGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATTCA
TGGATGTGAGTTGGTCATGTCGATGGGATGATGAAGAAGGACCCACAGGAAGGGTGTGGGCCAGGAGGAGGAGG