Description :
From Genome Similarity Track
Location :
Scaffold_1038:252- 4531
Transcript NameFunction/comments
Phyag_g9219hypothetical protein PHYSODRAFT_284526
Phyag_g9220conserved hypothetical protein
Phyag_g9221hypothetical protein PHYSODRAFT_477368

Sequence
4279 bases(100 bases per row)
CAGCACCAGTTGCCACGGCGACGGAGTCGTCCATGGCTGTCAAAGTGAAGAGGATCAGGACCAAGCAGCCGAAGGAGGTGATGCTAGGCATCTGCGGCGG
CGTCGGCCCAGCCGCGGGGCTGTTACTGCACCAACTCATACTGCAGAACACCGACAGCGCCGGAGAGGACCAAGGGCACCTGAACGTCTGCCACTTCTCG
CGCTCCGAGGACATGACCGACCGCACCGAGTACCTCGTCTACGCTGCGAGTTCCAGCGCTGATGCAACAGATTCCGACTCGGATTGTGGCTCCATAAACG
GAGAAGTTCCTTATGAATGCAGGGAATCGgtcaaggaggtggagaacccGGCGTGTGGCATGGCACGAACGTTTGCTATGAtgcacgctgcagccactgc
aggATGTGCTCGACTTGTGGTGGGCGTCCCGTGCAATACGTTCCACGCACAACCAATTTGGGACGAGTTTATTCGACGTACGGGCCGCGCGAGTTATGTA
CAACACGTGCACATGCTGGAAGAGACGGTGGCGTTCATCGCTAGGAAGCTGCCGTCGTGTAAACGAGTTGGGTTGTTGTCGACTACCGGCACGCGGAATT
CGCGTGTCTATCATGATCTACTGGAGCCTCGAGGGTACACAGTGGTGGAGGTAAATGCTGGAGCTAcacagcaggagctgcacgagtcgATTTATAACCG
CGAATGGGGAGTGAAGAGTACGGCTCCTGCGGCATCTCCACGCTCCGAGGCAAATTTTCATCGTTACGCGTTGCAGCTACGTGCGTTGGGAGCTGAGGCC
ATCATCCTAGGCTGCACCGAGATCCCGTTTGTATTCGCAGGTCAAACGCATTTTGCTGGCGTTCTCCTCATTAACCccatggtggcgctggcacGCGCCA
TGATTCGCAAAGCCGATCCATCAAGGTTGAAACTCGAAGATAACAAGGCAGTATCAAGTATGTGTTCTGCTGTGCCACTGAGTTCACTCACAGCACCTGT
AGACTAATAGAGCTAGATCCACAGTTGTTTTGCTACCTTTAAGAGTGCTTCCACGCTGTAATTGTCTTCTGCAATTAAATCAACGATGAAAGTTGGTTTA
AGAAGTCCGTCGCCTTctcggacgctgcagaatcgACCTCAGTACTCGTCGTCTTAGCTGCGTTTTCACTCGCCGCCATCGCTTCCTCTCGCTGTTTACG
AAGAAGCTCCAaacgttgctgcttcctTGTCTTCCTATCCACTGCACCCGATGCAGAGTGTGCCAACGACTGCGCAAGAGTCGCTCGCTCGTGCACTTCC
TTCAAATGGTGTTTCTCAGTAGTTTTCAGACGCTTCTCCCACTGCGAGACcacgaagctgccgccgtCCGCTCTACATTGGCCCTCTCTGTCCTCCATAT
AACCCTTCTCGCCACGAGACTCGTCCCTCTCAGATGTACGCTGAGTCTCCAAGAACGTCGCATACTCCTCACTGTCCGCCGCAACTTTTCGTGCACGTCC
GAACTCGTCCGTGATCtccaccatcgtcttctcctcttgGTTACtcaccgtcttcgtcgtGTATTTTTTCGCTTCGAAATCCACCAGACACTCTCCACCC
ATTTGGTCTTCGCCTCCATTGGCCATCGCTTCATACAGTTTTGCCTTTTTCCGTAGCATCTCCGCCGACTTTTTCCTCCaggcttcgtcgtcgtcttcat
ctggagcttctcgagcCTTTGCCTCTTCGTCGCGTCGACTGCGAGCCTCCACCCCTTTGTTCTTCCCCTTCTTGTCCTCATCTGATCGCTTACGGCGCTT
GCTGCCGCCTCGCAGATGTGCGTATTTACCCaaacgaagagctccagacgcgtcgtcgtcgctctcggcTGTTAGAGCTTCTTGGAGACGACGCTTTCGC
TCCTGGTCCTTCTGGAACACAACAGCCTTCAAGTCCACGAGCGACTTGGCGTCgaccttgatctccttggccttggacgGCACCAACGCAGACTCGGTCA
GGAACCCCAGCGACATATTACCCACCACTTTGTGTCACTTTGTGATTTGGGCATTTTTATGATTTGTGCCGCTTTGTGATTTGTgtgccacttcaacttg
gtggTTACGTCAATTGGCGCTAATTGCGTGCGTAGAGCACTGGGGTGCTGCTTGGACATTGAACACGCGCATGTCACCATGTTCCGGCGGAAACCGGTCA
AGCCCCATGTCGTGGCAGCTATCGAAGCCGATGTGGCAGCTACGAATCTCGAAGCAGGTGCTGGGACTGGAGAACCAGCAGGCCCAGCGCTGTCTTCAGA
GCCCGTCGTCTCGGGTCCGAGCAGTCCGAGATATGCCAGTCGAATACACAGGTTCGAAAACAAGACTGGCATTCAAACTGCAACTCCACGGACGCCCCCC
AACGGCCTCCGACGAACGAACACGTGGACGCGCGCAGGCAGTTTGATCAGAATGGCGTCGGAAAACACGAGCATCAATGTGCTGCGGATGTCGCTGTTCG
AGATGCACGATCGGATGAGCTATCGCTGGGTGCTGCATCCGCAGTCGCCATTCAAAACCTTTTGGGACCTTTTGAGTGCAATCGTTGTCGTTTACTACTC
GTGGATTATCCCCTTCATGTTGTGTTTCGACTGGTACGAGCCGTCACAAAGCACCAAAACCTTCATGCACGTGCTGGATGTATGGGGCTTTATGGATATT
TTACTGCGGTTCCGTACTGGTATCATCGAATATGGCAATGTGGTGATGAATCCGCGTAAAATCCGTCATGCTTACATTCGCTCCGTGTGGTTCCCCATCG
ACGTGGCGTCTACGTTTCCGTTCGAGTACTTTATCAAGGACGACACATCCAGTAtatcgacgaggaagacaaTCAAGATGATCAAGTATATCAAACTGCC
GCGCTTGTTGCGCCTCGGTCGATTTGTCAAGTATCTTAAGAAATACAAGCGCTACTCGAGCGTCACAATCGCGCTAAACACGGTGGTGTTTTCTGCCCAC
GTCGCGGGTTGTGTATGGGTCGCCATACTCAAACCGTGCGCTGATCCAATCGAGGACCCGCTACCGCACtgccaagatggaggagagaTGCGCGTCTACT
GGGTCGCCTTTCACCACGGCATGATGTCGTTATTGGGCGTGTCAGCGACGCATGTAGAGGCAAGCGATCGTTTTCTCAGTGGCGGGTTTCACCACGCCCC
TGACGACGATCTGAGCAGTGCGATCTACATTTGGTCCGGTGCAGTGTCGGTGTACGGTGCTATCTTGACAGCTATCCTCTTCGGAACAATCATCGGACTT
GTACAGAGGTATCCGAAGGAGTGCAAAATGTTCTTAGCGTGGCAACTAACCTCAATTCCTTGTGCTGCGATGTAGCTGGAACAGAGCTGAAAATGCGTTT
AGGAAGAAAATGGACCATGTCACGCACGAGATGGATGCGTTGAGTTTACCTAAGCCATTACGAGTACGTTTAGCTGCACTCAACATTCGGTTCTCTATTG
CTGACGATGCGTATTTTTCATCTTCGTGGTTGCTAGGCGCGAGTCACGGCATATTACGACTATTTGTGGTTAAACGTACGTTAGGCATTGCATTTGCTGT
TCCTGTGCATTCTTGCTACTAACTCATTGTCAACGCTGCAACCGTGACACAGAATCGAGCATTATCGGAGCAGCTAAATCTACTACATGATCCGGGCATG
TCGTTGACGTTGCGCCGACAAATCGCGATCTACCTGTTCAAAGACAACCTGCAGAAAATCCCATTTTTCCAGCTAGCCACAGACGCTGTATTGGGCATGA
TCTGCATGCAACTTCGTCAAGTTATCTACATGCCAGACGACTTCATTATCCGAGAAGGTGAAATCGGCAAGGAGCTGTTCATGATCGTGAAAGGCATCGT
ACGTGTCCTCCCACCCGACGGATGCAAGAAACCCGAGACTGAGACAATTATCTTGCTAAGCGAAGGAGATTTCTTCGGCGAGATAGGCGTGGTGATGGAA
GTCGAGCGAACTCGCAGCGTAAAAGCCGAGTGCATGGCGGAGCTCTGCGTCCTCTCTCGAGATGGTTTTGACAAAATCTTGGTGGAATTTCCAGAGTTTG
CCACCGCTATGAAGAAGTTGATCATCAAACGTGTAGGCGAAATGTGGAAGGACGACGGCCCTGAgcggatggagaagatgacagcacttgcagacgccaa
gatgaagaagaccatcCAAGCCTACAAAAACATGGGCAAGCTACGCAACAAAACAAGAATGCTATCAACCTTTCGTCCC