Description :
From Genome Similarity Track
Location :
Scaffold_2885:252- 1810
Transcript NameFunction/comments
Phyag_g12881putative polyprotein
Phyag_g12882putative polyprotein

Sequence
1558 bases(100 bases per row)
GAAGCGCAGACAACACACTGAGGGCCATCGCTCACTCTTGGTGTGGTCTTGGTCGTGGATTGAGGATcctcgacagcaacgtgcGGCCACTTCTCAAGAA
CCGCTAGTAGTTGCGCGAACGTCGCGCTGACGTCGTACCCACGACGTCGCTTCACCGATCGAGACAGCCAGTCGATGTCTGGCTGGTAGCGCGTCAGCCA
CGGCATCCCGAGAATACAGTCGAACGAGAGCCTCATGTCGATCACCAGAAACTCGTCGAGACTGGTGAACCCGTCGAACTCGTACGACAGCATCACAGAC
TTCCGGGGGAGGAGCCGAGGCTTTCCGTCGGCGAGCTTCACGGACATCTCGCCTGGACCTTCACGCACGCGGATACCCGCGGGGAGGTCAGACAGGCACG
ACGCGCGGACAAAGTTGTTCGTCGCTCCTGAATCGAGGAGGGCTCGCAGAGgtcgtcgcgctccagcgacgtgaagccGAACAACTATCAGCCTTGTGTC
GCCGCGCGATGTGGTAACATTAAACTGTGTGTGGAGCACAGTGGGGCTAGGAGGTCGGGCTGCTGCCGGGGGGCCCAAACCTCCATTCCAGCCAGTAGGG
CGCCCCGCGCCTACTGGTCCTGCTCGTTTTTTGGCAGCGCGGGCGAGGTAGCGTCGGCAGCTGCCGACGCTTCGACGACCGTGACTACAGGAGCCGGAGC
GCGGCACACCGCCGCGCGATGACCTGGCTTCTGGCAGCGATAGCAGATGATCAAACGGGGTCCGCGACCGCCTTGACCACCTCGACCTCCGCGTCCAGCG
CGTGCGTTTGACGACCGGGATGACCCGGCCGAGCCGTACTCGATCGCATCAATCTCCATGGGCTCCGGGCCGCCGTTGGCGCGTTCTTCAGCAGAGGCCG
CGCGTGCGTACGACGCGGTCACGGTGTAGTCCTCGCGGAGCGCGAGGGCGAATGCGGCTTCAAGCGTCTGCGGTTCGTCGCGAGTCAGGCAGTAGCGAGT
CATACCCTCGCGCATGCCGTAGACGAACACGTGGACTTGAGACGCCATGTCAATCGGGTGCGTCACCACGCACGAAGCCAAGTGGCGCGTCTTCTGCACG
TAATCGCGCATGCTCATTTTGCCTTGCTTGAGGGCGAAGAACGCCGCGCGCATCCGCGACTCATCTTGAGGCGGCTCGAACGCGAGGCGAAGGTCATCCT
GAAGGCTCTTCAGGGTGTCTAACGCATCTGGCTCGGTGACGAGTTTGCCGAGCGCCCATTCCTTGGCCTTGCCCGTCAGACGCGAGATCAGGAAGTTGAC
CTTGGACGGCTCCATCTCGATGCGTCGAGATGAAATCGCGAGCTCCACCTCGCGATACCATCGGTTCAGAGGCAGTCGGTCATTACCGACGCCGGAGTAA
GTGGACGTCtccaacttgaccacttcgTTCTTCATGGAGTGCGAGGGAGTCGATGCTCGCTGTTTCGCATCAGCGAGCTCGCGTTCCATGAACTGTTGCG
CAGCCAGACGGTGGGCTTCGGTCGACCCTGATCGCAGCAGGGTCGTCACGAGGGCCTC