Description :
From Genome Similarity Track
Location :
Scaffold_725:252- 1373
Transcript NameFunction/comments
Phyci_35753Hypothetical protein

Sequence
1121 bases(100 bases per row)
TCCCGCGCGGGGGCAAAAGAGCGGCTCGTCGGACGCGTTGCCCAGGGGCCCTTCGCACGGCCGCAGCGGCACGCAGAAGGTGCCGGAGACGCCCTCGACG
CGCACGGGCCGCTCGCCGACTCGCTCGCACGTGGAGGAGAGGGCCCGGAGGCCGAGCGCGCCCTGGGGGGTGGCCACTAGCGCCAGGCACAGGGCGGCGG
CCGTCCGCATGAGCTGGTGCTGCGCGCGCGTCCGTCGGACTGGGCGCTGAAGCCTGCGAGTCTGTAGCTCCGTCGTCAGTGCTCGCTGGCCAGCGCTGAT
ATGCCGCGCTTCGCGGAGCGCACCCACTTCAGCCGCTGTAACCGGCGTGCGTACCTTGTCTGCGTTCAGCTGCTCGGGCGGCGCCGAtcgctcgctcgct
cgctcgctcgctGCTGGGGCAGTGCGTGAGTGTACCCTCCTGTGGGGTCGAGGCGCTTGCTAGTGCGTATATAGAGAGAGCGCTGCTGCTACTGCTGCCG
CTGCTCCGGCCGGCGGCTGGCTGCGGCGCTATAGGGCGGATCTGACCACACGCGGCGCAGCTACACACGCGGTTCGGGGCTCGTGACCGGAAGTGGCGAC
CTGCTGGCCCCGCCCGCCTCGCCTTCTGTTTTGCTCGCGCTTCCTGCGACGGCGAGCGCTTCCTCTCACCCTGCGCCTCCGTGGGCGATTCTCGAAGTGG
CCGCGAACCCATTGAGCGCCGCTCGCATCTCAGTTGTGGGTTACGCGCAAAGACTGGCCTTCCTTCCCTCCTCCAGCGGTGGCGGCCTCCGTCATGCAAC
GACTCATGGAGACGACGCCGATGGCTTTGCTTCCTGCGCGCAAATCGAGCCGCGCAGCATAGGCTCGCCATGCGGCAGGCGCTCTAGGCAGATGCCGGCG
GCGCAGCGCTCGGCCCCCCATTCGGGCCAAGCCTGAGCAGGGTGATCATGACCATGGATTCCAGCGAAAAAATCACGCAAGCGACACCACCAGGGCGGAA
GCAACGCCACTGCTGCGCTGCCGGCTGCTTCGCGCCACCGTCTCTACGCGTTGACTCAACGCGTTTCGCCGAGTGCTTGTCTTGCCGTGTGTTGTCGTCG
TCGCCCACGAGAAGAGGGCGG