Description :
From Genome Similarity Track
Location :
Scaffold_2419:252- 1331
Transcript NameFunction/comments
Phymu_g14104hypothetical protein PHYSODRAFT_324441

Sequence
1079 bases(100 bases per row)
CACGATCTCGGAACGACGGAGTAGGAAGAAAAATGCCAGGCACAGAACCCCCCAAAGAGCTTGGTGGGCTGAGCTGTTGAGGTCGagcgcgttgaagcag
cGCTCCAGAAGCGAGATGGAGACCGGTGCTTTCTGGCGGCTTGGCGAGTCAAGACGGCCCAGACCTTTGAGAAGCATGCGGACCCGTGGATGGCTAGAGG
GAAAATGAAGGCCCGCAGCCGTGAAGAAGTGGGCGATGCCACAGAGCACAGATTTGATAGTCGAGGCGCGAACGGGACAGTTAGAGCCAAGCCCCGCTCG
AGCGCCATCGATGATGAATTCGGAGAGGATGCGGATCTGAACGTCCAGGGGTGCTTTTAACTGCCACGGGACACCGCGTGCGCGAGCCCATCGCTTCCAG
TAGGCGAAGGCCCGCTTGTAAGCTTTCAACGAAGAATCGGCAACGGAGTGCTctcgcagaagctgcgcCAGTCGTGTTCGAGATCCATGATGCtcgacgg
aggaggagcttgcTGCCATCCGCGTGTCGATTCGCGAAAAAGTTGGGCGATAGTGTCGTTCTCCCAGCGTCTCGACCCCGCGTCTGCCACGGTATTCTCT
GAGCCCGGCATGTGTGGCGCCGATATACGGATGCGGAAGGTGTGCGCCCATACTCCCAGAAGCCGGATGAGCAACTGAGCCCGTGAATTGCGGGACGACA
TTATCGATTGCCACGAGATCGCAGATGTGTTGTCGATTCGGAAGTGGACGTGCACGGGGAGGCTGTGCGGGTTCGTTGAACTCCATTCTGAGCCCCACGT
CTTAATTGCAAACGCGCACGCAACGAGCTCACGGTAGTTGATGTCAAACTCGTTAGCTTGCCCGTCCTTGAATTGTCGAATGAGGGCTTGCTCGTGGACG
GAAAATCGGTAGGTTAGGGCGAGGCGGTGAGTGGGGACGGTTGCACAAACCCCAGTGTCTGATGCGTCTGTGACGACTGTGATGTCCGATTCAGGCAGCT
CACCGAAGTACTCGAGAGGCACGCTGTTCAGCGCCGGATCGTGAAGAATGTACCACCACCAGGCGAGATCATCGTGCAT