Description :
From Genome Similarity Track
Location :
Scaffold_3734:252- 1327
Transcript NameFunction/comments
Pytir_DAOMBR486snap-pir_contig_3734-abinit-gene-0.0Transposable element Tc3 transposase

Sequence
1075 bases(100 bases per row)
ACCATTATCTTTTCTGATGAGAAGAAATGGAATTTCGATAGACCCGACGGTTTTCAACACTACTGGCGTGATCTCCGTCTCCCGCCCCACCAGACGGAAC
GATGACAAGCCGACGGTGGGTCCGTGATGGTGTGGGCGGCCTTCAGCGCCAGCGATAAGACAAAGCTGGTGATCTTACGCGGAAAGCAGAGATCCGAAGG
CTACATTTTACTGTCTCCGAGTATATGCTTCCGTTCGCCCACCTTCACTACGGCCTCGACTTTATCTATCAGCAAGATGGCGCGCCAATTCATACGTCGA
AGTGTACCAAAGCGTTCCTCGACGAGCAACAGATCCGCGTGCTGGACTGGCCGGCGCGATCACCGGACCTAAATCCAATTGAGAACCTATGGTCCATAAT
GACTCGGCGTGTCTACGCTAACGGGCGACAGTATAACAGTGTGGGCGAGCTGACGGTCGTGCTCGTCGACGTATGGAACTCAGTCGAACCTTCGGTTCTG
CGGACGCTCGTTGACTCAATGCCGCGTCGTTGTTTCGAGGTCATTGAGAAGCGAGGCAGTAAGCCTCACTACTAACATATCATCATCCGCCAATCATTCT
TTTTATATTGGCAATTGTATACTGGCCGGGTGCTCATAAATTTTGTCGCACCCCCAAAAATGGTTGTTTGTATGGCAGCCTATCGATAAATGCCATTTTG
GGAACGGTAAAAAGTTTTTTGTGCGTGTTTTTGCTTTGTGAACAACATATCTAAACCGCGTCGGGAAACTCGTAAGATTGGCTGAGATACGAACCAAAAC
GTGGGTGCTCATAATAACTTGGCACGGAGTGTAAAAACTGGATACAAAACTGAATAAACAAATCACAAAAAAACACACTTGCAGCAAAAGCCCTACTCGT
AGATGATAATGCCGCTGACAAACTCGGAGACCAACACAAGTACTCGCCGACGAGAAAGATAGAACACGAAGAGCGCCGCAGCGACCGCCCCGGACTTCAG
AGCAGGGTGCTCAGCAACGGCAACACGTCTTCTGCAGCGGCAGCAGTGACAAGACTTTCGCTGTAACCGGGCGTT