Description :
From Genome Similarity Track
Location :
contig_193:25190- 26399
Transcript NameFunction/comments
g12023.t1hypothetical protein PHYSODRAFT_538218

Sequence
1209 bases(100 bases per row)
GAGCAGGCGCTGGCGGAAGCCGCTAGCTTGGCTGAGAGCGCCGTGGATGAGCGTTACTTCTCCACTGAAGACTTCGCGTCGCTACCGCTGTCCGATCCCA
CGCGAAAGGCGCTGGCTGACATGGGCTTCTCCAAGATGACCAAGATCCAGTCCAAGTCGATCCGCCCGCTGCTGGCTGGCCAAGATTTGCTGGGAGCTGC
CAAGACGGGCTCTGGTAAGACGCTGTCGTTCCTGATCCCCGCTATCGAGCTGCTGCACAAGGTGCGCTTCACGGCGCGCAAGGGAACGGGCTGCATTGTC
ATCTCGCCCACGCGCGAGCTTGCTTTGCAGATTTACGGCGTCGTGCGCGACATCTGCAAGTACCACTCGCAGACCCACGGTATTGTCATGGGAGGTGCCA
ACCGTCGTGCCGAGGCGGAGCGTTGGTGAAGGGTGTGAACATTCTGATCTCCACGCCCGGTCGTCTGCTGGATCACCTGCAGAACACCAAGGCATTCATT
TACCACAATCTGCAATTCTCGTGATTGATGAGGCCGATCGAATTCTTTCTATTGGTTTCGAGGAGGAGATGCGCCAGATTATCAAGTGCATTCCCAAGGA
GCGCCAAACGATGCTGTTCAGTGCCACACAGACGAAGAAGGTGAGGACCTAGCTCGTCTGTCGATTAAGGAGAAGCCTGTGTACGTGGGTGTTGAAGAGG
AGGACACCAAGGCCACTGTCGCTACGTTGGAGCAGGGGTATGTTGTGACTCCCAGTGACAAGCGTTTCCTGCTGTTGTTCACGTTCCTCAAGAAGAACCT
GAAGAAGAAGGTCATGGTTTTCTTTTCGTCGTGCAGTGCTGTCAAGTTCTACGGTGAGCTGCTGAACTACATCGATATTCCTGTGCTGGACATTCACGGC
AAGCAGAAACAGAACAAGCGTACGACTACGTTCTTCCAGTTCTGTAACGCGAAGACGGGTATCCTGCTTTGCACGGATGTGGCAGCCCGTGGTCTCGATA
TCCCGGCAGTGGATTGGATTATTCAGTTCGACCCGCCTGATGATCCGCGCGAGTACATTCACCGTGTCGGTCGTACGGCGCGTGGAGCGAAGGGCAAGGG
TAAGGCCCTTCTTATGCTTCTGCCGGATGAGCTTGGCTTCCTGAAGTACCTAAAGGCCTCCAAGGTGGCTCTTAACGAGTACGAGTTCCCCGTCTCGAAG
ATTGCGAAC