Description :
From Genome Similarity Track
Location :
Scaffold_749:2519- 4115
Transcript NameFunction/comments
Phypl_g10737conserved hypothetical protein

Sequence
1596 bases(100 bases per row)
CTGCCGCCTTGGACGGAGTCATAGCAGCATTGTGGTATCCGCTCTCGGGCGTCAAGTCCAGCGGTCCGAGATCGCTCTTGGTACCCATCGGGGCCAAGTT
CTCTTTGTActcttcttcgtgcttcTTCGGGGCGAGGCTCATTTGGTAGTTCACCtcctcttgctgcttcttgtttTTGCTTTGGACGAATGCGCGCACC
GAGAGAGCAATGGAAAAGAGTGTGGCAAGACCACCGCCGATCGTCACGAGCCACTTCCACAGAGGCCACCGGTCGCATTCCGGAGGATTCGTCCAGTCCG
AGACGCACACGCAGGTCCGCACACCATCCACAACTTGGACGCTAGCGCGCTGAGCGTTGCAGCTGTCCACTGTCTCGTCAGCATCCACCGAGCTAGAGGC
TGCGCCCGTACTCCCAGAactcgaagtcgtcgtcgtcacctgcACGTCACTCGCGTCGcacgtggcgtcgctggaatCACCAGCTTCCACAGTCACCGCG
TGCTCCGGTGACGCCTCGCGACAGGCATCGCTGCCCCAGCCTCGAAAGTAAATTGTGCCTGCGGTCTTCGCACAGATCAGGAAAGTATCcgacttcttct
ccgccgccgtgtccGAGCTCGAGGGTgtcaccgtcttcttctgcccGGTCTTGAGCGAAACGTACGTGACGTTCTCAACGCCACTCCACGTGAACGAAAT
GTAGGATCCAGCCTTCACCACCGCCGTCACGCCGTTGTCTCCGTACGACACGCTGTCGCCATAGGTCGGATCGCCCAAATTGgcgcagtcgaagcagcag
acgcctCCTGTCGCTTTCGTGCACTCGGTGAAAACAACCGGGTCGTAGCTGTACGGGACGGACGAAGTCTTGCCAATGCACGTGTTGCAACAttccgagg
acgagctggcggctTGTGCCTCCAAACTTGCCCAAGTCACACCGAGAGCCAAAGCCGacacgacgaggtggagcgccAATACCACCGGCCGGTGGTTCAT
CCTGCGTACTGCGTAGCACGTAGAGAAATGACGCACGGACGCAATTACATACTCCCACCGCAGTCGTGTGCACGAAGTTCACGAATACAAAAGCACTACG
GCCGGATAAAAAGAGGCGGAGTGTGCTCTCGTAAGGACGATGGTGTCTGCTGTGAGGTTGATGGCCGACCGACTATCGATGCCTTTCCCTGAGGTTCGGG
AAATGGGCTGTCGAGTGAATACATGCCAAGGAAGGATTCATGGCCAAGCAGATTCATTGAATCTGCTTGGACCATGTCATTCATGCAGTAGAGAGAggat
cagactgtctattGAGCTACTTACATGTACTGTATCACTACGGTACCGGTACTTCTGGCATTCACACAGTAAGTATCGCTTCAATTGGGAGGACGTAGTA
GATTTGCTTTTCATGCACATCTGCAGTGCTTCACTACAATTTGCGATTAGTCGATTTGCTCACACGACAAGTTGTCGGACAAcatactgtacatgtacat
gaaGTTTGCGGTAAGATCTAGCTCGTTCAAGCTGGATTTTGGTGAGATTTCATCTTCGCTGTTCGGCATGGCTCTGCTTGCAAACGTGCTCATAAC