Description :
From Genome Similarity Track
Location :
Scaffold_1369:2519- 4100
Transcript NameFunction/comments
Phyta_totarag12810hypothetical protein

Sequence
1581 bases(100 bases per row)
TGTATTCCAAGGTATGGGTCGGGGGTTAACCAGGTGGCGTGGGTTAGTGGTCTAAACTTCTGGACCGAACGGTGTGGACTGTGGGTTCGATCCCACACTG
TACAAATTCCTCCGAGCGGGGAGAAATAGGACCTCCCAAGAAGGAAACACACCTTGGCACAGGCAGTTAGTGCACCCTGAAAAGATGGGGAAAATGTAGA
GAACAGTGTATGGATTGGGAGGCAGTTCCTGTATAGAGATTTCCTACATGATGGCCTCGGGTGCTCGAGATTTCGTTGGCACAGTTCCTCTGGGGGTTCG
GGACGGCCAGTTTAGCCCATTGGAAACACGTAGCCCACTCGCTATACGTAGCGGGTAGCGATCCCGCATGTGATCAAGTGTAACCTAGCCTCCCCCACAA
CGAAAAATAACAACTCTTGGCCCATTAGAAAGGTATGGGTCGGGGTCGGTCTGACCGGCTACCCGGAAAAGACCCGTTTACTAATCTCCCTGTCCTCGAC
GCGTGGCAATTGCTTGATGGGGCTCAGTATCGCGCTGGAAAGAGAGGTATCTCGAGACCAAGTGCAAGCACTCACCGCACGTCTCACTCTATGAGCACCT
TCACATCCGCGTTGAACAGGTCATTAATCGGTGCAGGATCGCTTGGTTTTTTTAGAATCTTGGTCGGTATGGGTTTGAACATGTTCGAAACACTTAACAA
CTAGAACGAGCGCTGGGGTCAACCAAGCGCAGCCAATTGCTCACGATGCACAATTAGTGATGCCATGCTATTTAGAGGCCATGACTTCTGGTCAATGAAA
AAAAAAGTTGGTTAAACGTCGAACAGATTAATACTATTTTTAAATTATTATATTATACTACGTATTATAAaattgtcaattccgtctaacTTGCTGATAT
TAGCCGGTTAGCTGGACGGtcccaatacaattctcaagttATTTACGTCaatcgactgcagcaaaaacagatgttcttggaatttcacttaagtccgatt
tcgcAATTATAAAGTGCTCATAGTgaattgaagtgatttagccgattcaataaaccgtgtgcggaaacttcgagtagaacgcgcaatagTAGTTCTTTCT
AACCGACCAGTTCGGAGGTCAGCCAAAACCATACTTTGATAATTTACAAATTAGGTCAAGTATTTGTGTGAGTAATAAGACGAATACGCGTGCAAATTTG
AGAGTAAGTACATCTATATGTTGATCATTTTGAAACAAGATGGATCATTCGCCAGCCCCATCAGTACATACTTAATAAATGTTGCTCTTCAAGATGCGTG
CTGTAACGAGCTAACAGGACCCGTTACCAGTTTACACTCACGACTGGGAAGTTTCAAGCAAATTAGACTCTGAGCTGTATTGAATCTTGACGGCCTCCTG
CGAGACCGTCCCAATCAACAATTACTCTAAGCAGTACGATTGGTCACCGTCACACGAACGGTGACCTGTGACAGAGGCCCGTCACATCATTTCCCACTTG
AAAGCGAAGCTGCGAGCATGGTTCGAAGCCAGCGAGCTCAGTCTTCAACATCGCGGGCCGGAGCAAGATGCAGGACCAGGA