Description :
From Genome Similarity Track
Location :
Scaffold_39:25187- 27060
Sequence
1873 bases(100 bases per row)
GTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAAT
ACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAA
GTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGGAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCG
CAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCA
TGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCTGAGCGGTATGCTCTGGGAGTGGCTGGTGATGTTCCAGGGGCTGTCGAACGCACCAGCAAC
GTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTAACGATATATTCGTCCATATTCGTGCCGAGCACGGAAAG
TCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTTATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGG
AGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTAGACTGGCCGGTTCCCAAGAACCA
AAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGCACAGCGCGAATTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAG
GACGCACCATGGTGCTGGAACGTCGAGCACGACGGGGCCTTTAAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATA
GTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTC
TCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGC
TCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTG
CCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGTCGGACTACGAGTTAGCCCATGTCACGAC
AGTGACGTCGTCAGTGCCTGACTTGATAGGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTCTAGAC
TCTGACAAAGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTC
GTGTAGTCGTTCCTCATGATGAGGATCTCAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGG
CTCGGTGAGCACGATGTACTGGTGGCCCAAAATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGC
ACGGCAGCGCTATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTG