Description :
From Genome Similarity Track
Location :
Scaffold_511:2518- 4700
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_511-snap-gene-0.3Dynein heavy chain

Sequence
2182 bases(100 bases per row)
ACAAGGACAACATCCCGCCGGCCATCTTGAAAAAGCTCGCAGTCGTGGTTGCCGACGCGGGCATGGCCGTCGAGGTTGTCTCGAAAGTCTCCAAGGCCGC
GACGTCGCTGTGTATGTGGGTCCACGCCATGGACGTGTACTCAAAAGTGGCCAAAGAAGTCGGCCCCAAGCGAGAAAACCTAGAAAAGATGAACAAGATC
CTTGCGGACGCCAACGCCGTGCTCCAGCAAAAGCGAGACGAACTGCGTGCGGTCAACGAAAATGTCGCCAAGCTCGAAAAGCAGTGCAAAGACACGTTGG
ACGAAAAGGACCAACTCGCACGGGACGCTGCGACCACTGAGAAGCGGCTCGAGCGCGCTGAAAAGCTCATCTCGGGGCTGAGCGTCGAGGGCGCACGATG
GAAAGAGAGCGTCGCGTTTCTCTCGCAGTCGATCTTGAATCTGATTGGAGACATCTTTTTGGCGTCGGCGTGTATCTCGTACTATGGTCCGTTCACGGGT
GCGTTTCGCCAACGCATTATTGACCAGTGGGTCACGAGCACGCAGGCGCTCGACATTCCGTGTTCCGCAACGTATGCGCTGGCCAACACATTGGGCAGCG
CTGTGGAGATTCGCGACTGGCAACTCAACGGACTACCCACCGACTCGACCTCGACCGACAACGCGATCCTCGTCACTCGCGGCGAGCGGTGGCCGCTCAT
GATTGACCCCCAGGGCCAAGCCAACAAATGGATCAAGAAATCCAATGGTTCCGCTCGACTAGAAACCACGAAAATGACCAACGCGAACCTGCTGCGGTCG
CTCGAGACCTGTATCCGTAACGGGAAGGCGCTACTGATCGAAGACATTGACGAGGCACTGGAGCCAGCGCTCGAACCGGTGCTGCAAAAGGCCATTTTCA
AGCAAGGTGGGCGTCTGCTCATTCGCCTGGGCGACTCTGACGTGGATTACGACCCGTCTTTCAAGCTCTTCCTCACGACCAAGCTTCCAAACCCGCACTA
TCTCCCGGAGGTGTACATCAAAGTGACTGTGATCAATTTCACGGTCACGATGGACGGGCTTGAAGATCAGTTGCTTGGCGACGTCGTGCGGCACGAGCGA
CCCGATATCGAAGAGAAGAAAAACCGCTTGGTCGTGACCATGGCCCAGGACCGCAAGCAGCTGAAAGAGATTGAGGACCGCATTCTCAAGCAGCTCTCAG
AATCGACGGGCAACGTGCTCGACGACCAAGATCTCATTGACACCTTACAGTCCTCGAACGCGACATCGAAAGTTATTAAAGAGCGTGTCCTCGAGTCGGA
GACTACCGAGCTCGAGATCAACCGCGCAAGAGAAGAGTACCGTCCCGTCGCTACCCGGGGGTCGATCATTTATTTTGTGGTCGCCAACTTGGCGCTTATC
GACCCGATGTACCAGTACTCGCTGCCGTTTTTCCAGCGGCTCTTCAACATTTGCTTTGATGAGGCGCCCAAGTCGGACACGCTGTCGCAGCGCCTGGACA
ATTTGATCGTCTTTCTCACGCGATACATCTACGTCAATATTTGCCGTGGCTTGTTTGAGGCACACAAGGTGCTCTTCTCGATGCTCATTTGCTGCAAAAT
CATGATGCACTCTGGCAAGATCTCGTCGCAAGAGTGGTCACTGTACCTGCGTGGTGCGCCCGGTGGATCAGGGAACGCTCAGCTAAAGAACCCCATGCCT
GACCGCATCACTGAGCTGCAGTGGACGCTTCTTCAAGAACTCGAGTCAGTCGTGACTGGCGGTCACGCCAGTGATGGAGCGGGCGAGGCCGACGCACAGG
TGTGTGGCTTTCAGAATATCTGCACGTCGCTCACTCAGCAGTCCCACGAGTGGATCGCGTGGCTTACGAACCCGTCGTTTCTGTCGGCACCGTGTCCGGC
GCCGTACGAGACGACGCTGTCGTCGTTCCAGAAGGTATTGCTGCTTAAGGGGCTCGCCGAAGAAAAAGTACCGCACGGCATTTTGAAGATGATCGCGACA
GAGATGGGTGCCGACTTTGGCAAGATCGCGCCGACGTCCATGGAGGACATCTACAACGACACGGACCGCAAGACGCCGTGCATCTTCGTACTCTCGGCCG
GTGCTGACCCGACGGGCATGCTGCTTCGCTTTGCGAAAGAGATGGCGTTCAGTGATCGGCTTCATCTCATCTCGCTCGGCCA