Description :
From Genome Similarity Track
Location :
Scaffold_34:25177- 29916
Transcript NameFunction/comments
Hyaar_Emoy2804981hypothetical protein
Hyaar_Emoy2804982hypothetical protein

Sequence
4739 bases(100 bases per row)
CGACAAGCGATTGATCGTGCTTAGCGTGCACGTCGTAGGTGCGACGCAGCCGCCTGGGCATTGCTGGATTCAGGCGCAACAAACACCTTTGTTCACGCCG
AAAGTTTAAGGATTCCCCGCGGCTGTGTGTCCACGAGTCTCCGGGTAATGTGATCGTTAAGTACGCCGATGGAAAGCCGCATATTCACCGACAGCGGTCG
GTCGTCGTTTTCTACCAATTTGAAGACTCTCCAAGTTGCGACAAGTTTCAAGTCATCGATCTTAGTGGGTCTTTTGACTACATATTGCGATGCCGTGGCT
TGTGCGGCATAGTCCAGAAATCGATTGGCTCAATTGAACGAACAGTACAACTGCGTTATATCGATGTCAACGCTGTACTTGTAGTCCTTGCGGACCCCTT
GAGTGTCTTGCAGCATGTTGCCGTCGTGAATTCAATCTCCCCGACCTTTAATACCCGCGAAGCGTGCGATAGTCCCTTGCTCGCGGTATGAAACACCGCT
ACGTGCTCCTTTTCCGTCGAAAACCGCGAGCGCAAAGCTGTGGCTTCTCCGCGTCCAGTGATGACTCCGATTCGACTTTCATTTCTCGCAGTCGTCGTGG
ACGTCGTACGCGTGTTCGATTTCGTCAGTCGGGTTTCTCTATTCTCGTTTGGCCTTGTCGCTCAAGACCATTCATGTCGTCAACATGTCAGATCGGGCCT
GCGCAGTCATTCGCTTCAGGACGCGAGCCCACCTCGCAACGCGCCTGGCATCACGCAGCTTCCCGAGATCTCTTGGGAGGAGTTGCTGCATGATCTGAAT
AGGGGGGGGGAGGTTGACCTACTATGCTTAGTGGTCCAAGCTTTCGATCTTGACAACCATGAACGCCGTGCGGGCATAGGACCGACGACGGCTTGCGAAA
AGCACTTCGCGGAACAGACATAGAAAGAACTTGCAGCGTCTGAGAATCTGACTCCTGAACTCACCCGCGAGTTTGCCGACGTCTTTCCGGCCAAGATCCC
AGCTTTTCTCTCTGCAGACCGTAATGCATGGCACGAGATGAACCTCGTGCCTGGTTTGAATTACTGCTGTACTCGACAGTGGCCGCTTCTACGTGAGTAA
GTGAAAGCCATTGATGCGTTCTTTGAAGGACGTCGGCTTGCGGGCCACGGGCGCGAGAGCACGTCGCATCAATGTAGCCCGACGTCTTACGTCAAGGACG
CAACCGGGGGATGGCGTATCGTCCACGCCTTTAACAAGTTGAACCATGCAACCATACCAGCGCAGACACCTATTCCACCCAAAGATATGGTTCTAAACAC
CATGTCGGGCAGCGCGATTTTCTTGTGATTGGATTTGACGGATGGATTTTATCAGATCCTAATGCGCCCCCTAGACGTTCCACTGACCCCCGTCACCACG
CGTAGCGGTATGCTCTGGGAGTAGCTTGTGCTGCCGCAGGGACTCAAGAACGCCCCTGCCACGTTCAGCAGCTCGGTGTCTCGCGTACCGCGTCCGTTTA
GCGATTTTGCGCCAAGTTGTTTCGATGTTGTTCACGTTCATAGTTGCGCTGCCAATAGCGCGACGGACCTTGATGTCCACCTCGGCCACCTCAGACAGGT
TTTTCAAGCATGCGGGTAATAAGTGGTACGAGAATAAGAAATGTACCTTCTGCGCGCCAGAAATACCAGGCTTGGGTAGCTACGTCAGCGAGAAGGGTGT
TTGCGCTGACCCTGAGAAGGTGTCTTCAATCTGCGCATGGCCAGTCCCGAATGACCAAAAACAACCACGACAATGGTTGGGGCTCGCAAACTATCTTCAT
CATTATGCAAAAGATTTTGTAGCAGCCATTCACCCGCTGTCTCAATTGTTGAAGAAGAACGCCACATGGTCGTGGCATTGGAAGCTCCAGAAGGCATTTG
ATGAGGGCAAAAGGCGCCTCTCGACATCGCCGGTGTTACCGCTGTCCAACAATTACATGTCATTCTATGTCGTATGCGATGCGAGCGACTTGCGATTTTA
TGCGCGCTAACGCAACATTACGACGCGGGTCATGAACGCTTCGTGAGGTTATAGTCTCGCCAATTGAAGCCCTTCGTGCGCAACTATCCCGTCCGCGACA
AGGAATTACTATTCCTTGTTAAATTCCGTGTTTACTTGCTTAAAGAGCAAACATTTGCGCTCTACATGGATCAAGCGTTTCTGGGTATTGCGACAAAGAG
TCCACACCTCAGCCAGCGAATGGCACGCTGATTGTCGCTTTTATCCTAATGCAAATTCGTCGTTAATTACAAGCCGGGATTGACCAACATCATTGCTGAT
GCTCTGTCGCGTCGCCCCGACTATGGCCCCCGTGAGCATATCCCCGTTCATGTTCCGTCAGACGGGTGCGACGACGGCTGTGCTGCGTGTACAACGCTTG
GCAACAATGCTACTGTGGTAGCCGCGCTTAGCCCCCCCCCTCGCGTTGAGACCGTGAACGCTAATGTTCGCGATGATTTTTACGGCCCACTTGTCCAATA
TCTTCGTGATCCGTCAGCCACCATGTTACTCAAACTTCCTGTCTCGGCGCGTGCTCAAATCTCGCGCTATGCCCCTGCCGCTGGATTTCTGATGTATCAA
ATCGATCGGTTTGATCCTGCTTGCATCATTATACTACTTAACAACGATGTTCGTGGTCTCATTCTTCACTAACATCATGACAGCGCGTCGGGCGGCCATA
TAGGCCGTGAGAAAACGTATCTTGCGCTATAGTGGTTAAAGGCGGCAGACTGTAAATCTGTTGAAATAATTTCTATGTTTTCCAAAAATAATTTTTATTA
AAGTCTCAAAATTTAAACCTAAATGTTTTACTATCCAGTGAGTTTTATTTGCCCCATATGTACAAGTAGGTCTGCAAATGGGTGCGTTCTTGTGATATTT
GTCAACTCGTGAAGCCTTCGTCTTCGTCTTAAGCCCCACTCCGTCCATTGCTAGTTGCCACAGAAGCATATCACTTTATGAGTCTCGACTTTGTCTTCGG
GCTGCAAGCTGATGCGCAAGGCCGCACCGGCATCCTGGTGATCTGCGATCGCTTCAGCAAGATGGTGCAACTTGATCCAGCTGCCTCCTTCATTACAGCT
GAAGAGACGGTGGACCTGTTTATCGACATTGTCTTTCGACATCATGCCCTTCCTGCCACGATCGTTTCCGATTGCGGTCCCCGCTTTACAACCTCGTTCT
AGTCGCGGCCGCTTCAACTACCTGGTACTTGGTTATTAATGTCCACGGCTGCCCATCCCGAGACTGACGGCCAGGCTGAGCGTGTTAACCGCGCGCTTAA
GGACGTGTTGCGGTCCTTTGCCACGTACTTCTTTATATGGAGTATGTTCCTGCCCATGGCGAATTTCGAGCTTAACAACGCGGTGCACGCGTCGACGGGT
TGGATCCCTTTTTCAGTGAATAATGCGTACCACCCTCGTTCTCCTGTTCTCGTTGACTTGTTGGTGTCTCTACTCCTGGTGGGAGTAGGACGCCACATAT
TATGGCGTCGATGGATGCTACAGTGACCAACACTGTAGCCGTAAGTGTTTCGAGTGCTAGACCAGGCGCAGATGCAGACGGATCTGTTACATTGCCGCCA
CCCGAGCGTTTGGTCAACGCAACTACGGTGGCTACAACACACTCATCTACCTATCTTGCTCTTTCTGATATTCCGCAGTGGGTCTGCGAGTCTCTTATTA
ATCCGTAACAGGGCGCTCTCCGGCTAGGTCAATCTTTTCAACTGGCACATGTCGCCATGCCGCCGAGTGCTCGTCTCTCAGACTCGGCGGCCATAAATGC
ATTCGTTCAACAACGAAAATGAGTCGTGAGATTTATTCGTGATGCTATCGCACATTCGGTCGACACGCAAAAGGCGGCCGCAGATCAACGCGGTCAAGAG
AACTATGAGAAGTTTGCTCTCGGAGACAAAGTGTTGCTCTCCACAATGGTGAGCATACTCGCGCCAAGGAATATTGGACCTTTTAAGGTTATCAAAACTA
TTGGCAATGCATATTCACTGGATATAACAACTACAATGCAGCTACATTCGACATTCTACGTCGGGCGTTTTAAGCGTTATCATCCGGCGCTTCTTTCGTC
TCTGTGTGCGACACCGTGGGCGCATACCGAGGTCATATATGACGTGACGGCCTCGGCGGATCTGAAGGACGAAAGCCACGCTGCACCGCATTGTCATGAC
GAAGAACCTCGTTCGACTGTTACAAATGCTCAAGACGCTGCACTAGCCCAACTGTCGCCACCGAAGCATTCTCGCAGAGCCTCTCAGCACTCTCCGCAAC
ATCGCGTACCAGATGTACGTCGTATCAACGAAGTCCATGAGCTGTTCCACCAAGCATAGCCGCTCAACGACAGAGACATCAACAACAGGCTCCTTTCTCG
CGGCACGGGTCATACCAAATACCATTTCGGCGCGACGGTCCTCCCCCGCTGATTGATAGCGATAGGTATCAACGTTGGGTGGTTGAGCGTATCCATGAAC
ATCGCGACACGCTGGATACTGCTGGTCACGGCGGTATGCGCTGCGACACTCACCCCTTCGCTCCAGTCCCGTACAAAAGACGCCGATAAATCGCGTACGG
GGGGTGGGGTTCCCTCCCGAAAGCGACTCCTGGGAACCCCGTACCTCGCTTCTCGCTGATGTCCCGGACGTCGTAAACGAATACGACCATGAGGTGAACG
CGAACACGAACGTGAACGCGAGTGTCGAGTCACTCGCGA