Description :
From Genome Similarity Track
Location :
Scaffold_196:25175- 26766
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_21628Hypothetical protein

Sequence
1591 bases(100 bases per row)
GGCTTGAGCCGAACCGTTTCGGATGTCGACCAGGCGCGAGGTGTCAACAATGACCACAACGGCGCTCCAACTCGGCAAGCGAACAATGAAGGCCCTGTAT
CTAGACCCAACGACGGAGCTTGCGTCGCGGCCCAGGGGCCCTTTGTTTGATGGGAGAAAGGCCACATCGGCTGCGATGCATGACGATATCCACCACAGAT
AGCGCCAGCGACGTCCTACGAGTGATGCAATCATAGACAAAAATGCCAACCGTGATTTCGTTTCAACGCAATAATTAGGCACGAGGCAATTCAGTTGACG
GACGTCTCGACGGCGGCAATTGCTGTTGGCTCGCTGCGTCCTTCCTTTGTGACGACTGCCTAGCGTGGTGCTGCGTCAATGCGCGTTCGGATATCTGCTC
GCCGTAGCACGACGCATCCTATCGGAGGAGCTGCGTTGAGTGGGCTTTGCGGCTCTGTGTTGTGCGGCAACTGCCTACCTTGCACCACTACCAAGTCCGA
CGTCCTGGCCCTTGTGGCACCACAGCATGCATTCCGAGTATTCCAAGGTTCTGCATGAGTATGCACAACCTTGTCAAGAGTACCTTATCAAGTCCCTATT
ACGTAGTCCATAGTTTCGACCGTCCATGACGAGCCCAGAGCACGTTACGTTCGACGCAGCCTTCAAATTCCTCTACGACTACTTTGGTGTGCCGAGCAGC
ATCCAGGTGCCCAGGTGCACCATATGCCAGCTTGCAACGATGCCCGCACGACGACACGTTCATCTGAAAGGCGAGGCACCTTCATGCTCTGGAGCGCTTG
GACGTTGTAAACTGGTAAGAACACTTTCTTTGGATGAACCACCGACAACATAGCGCGCCTGCGATTGCAATAACGCTTGATCGACGAAGAAGCACGAGTA
CCTGGCATGGCTGCCGACGACGACATGGCCGCATCGTTGTGGCCTGTAGCTGGTTGTAGCCTGTGGCGACGTCCGACGACGCCAAGACCGATGACGCTTG
GGCGACTGCTACTGCGAAAGTGAGTCACCCGGAGACATCCTCGCACTTGGTCGCGTCATTCTCGAATTTTGCTGCCAAGTCCCTTGACACAAGTGCAGTT
TTTCGACTTCACAATCTCGAGCCGCGCTCGTCGTTCACGCCGACATGTCGTCACGCATGTGGTCAATAGTGTCCATCGGTAAATACATATATATTCATAA
AGAAATCAGTTAACTAACATACCCGTTTGAGTGGTACTGGTACCGGTCGTACCTAGTGAATGTGAAGTCCCTCTCTTCTTTTCAAAGAGGCAACGTACAG
GCGGGTGCGCAGACTGTTGCAGCTCTGGTCGGCCAGTCGCTGAGCGTGGAGCCGAACTTCGCTGTCAGACGCGCCCACACAGAGGCGATCTTGTAGCCGG
CGGAGGAGCAGCGGGACATTTTGCCCCACAAAGCACGGAAACGGTGATTTTTCGCCGTCATGCTCACAAGCGCCAAGATCTACAGCAGCAAAACCCATCG
AACATCATTGCCACTTCAAATCCCACACGGTACACGAGGCGCGTGGTGCTGGAGGGCTAAGAGACCGTCGCCAAGGAGCCGCAGAAAACGC