Description :
From Genome Similarity Track
Location :
Scaffold_19:251723- 253646
Sequence
1923 bases(100 bases per row)
TTGACCTGCCCAAGTGCTTTTGGCAGTTCCCACTGCACCCGGACAGCTGGGACATGCTGTCGTTCATGCTGAACGGATGTGTGTACACCCCGGATCGAGT
GATGCAAGGCCATGTGGGTAGTGCCCTCTACGTACAATCAACGAACGAGGAGTCTACAAAGACCTGCTCTACAAGAACATGCTGATCTGGATCGACGACA
TCTTTTTGTACGCCGACAAAATGGAAGAGTACGTGGATGCCCTCGAGTCGTTCTTCGATCGAGTGGCCCAGTATGGGTTCAAGCTGAGTCCGGCCAAGAC
CAAGCTGTTCACGGACCAAGTCAAGTGGTGCGGACGCATCATCAGTGGTGATGGCGTCAAGCAAGACCCTGAACGCATAGAACATCTGTGTGCAATCCCC
TACCCTACGAATGCGGGAGAATTGCAGCAGTTTGTGTGCGCCGTGAACTGGCTGTGGGACTCGATGACAGAGCAGGGGCAAGAAGAAGCGGATCGCGTCT
GGTGTTCAGTTGGAACTGACCGACGGCGAGAAGCTAGCGTTTGATGCCGTGAAGTCCAAGCTACGATCATCAGTGGAACTGTCTCACCCGCGTGATGACG
CCAAGATGTGTTTCTTTACGGATGCGAGCGATCATGGATGGTCGATTGTGGTAACTCAAGTGGTGGCATTCGATGATGACAGCCCAGACCAAGAACAACG
TCACGAATTGCTCTTGTGTCAGTCGGGGATGTTTGCGGGCGCCCAGAAGGCGTGGTCAGTCATCGAAAAGAAGGCCTACCATATTGCGCGTGCGTGCGAG
AAACTCAATTACATGCTTATGCGACCTCCGGGGTTCAAGATGTACTGTGACCACAAGAACCTCATCCATGTATTTGCCCGGGCGAAGAATGGAAGGCGCA
CACACGCGGCAAACTCATGAGATGGGCTGCCATTATTGGCGGCTATCGTTATGAAATCATACACATCGACGGCATCCACAACCATTGGGCGGATATGATG
AGCCGTTGGGGTCAGCCGAACCAAGTCTGGCGACCAAGCGGGTCAAAATACGTCGGGGCCATGGCTGGTCAAAGAAAGTCAAAACACGCAAAGTCCCCCC
ACCGGCACAACCAAAACTTCGGCCGCTGGACAAGGACTTTGTGTGGCCATGTGTGATGGACATCCGTCACGCACAAAACCAGCATGGCGAAACCAAACCA
AAGCAAAATACTGTGGTGAACGCACTGTGACAAGTGGACGAGCGGCTATGGATACCGAGTGCGGCGAATGACCTGATCCAACGGATCATGGTCGTTGCCC
ACTGCGGCAGCGCCGGGCACCGTGGACATGCAGCGCTGATGGCTACTATCCGCCGCCTGTTCTATGTCGCCCACTTGGCCGACAGGGCCAGTGAATTCCT
CCGTGGCTGCTTGTTGTGCCCTCATGTAAAAGGGGGAAGGGTGGTCCATCGACCGTATGCTCCCAGATGGCACGCGAAAGAGCGCAACGAAGGAATCCAC
TTCGACTACCTCTACATGGGCGAAGTGTACAGCGGCGCTAAGTATGTGCTGGTACTCAAAGACGACCTTACCCACTACTGCGAACGCATTGCATGCGATG
GACCCACGAGCCAAGTATGTGTGGATGCCCTGGTCGACTGGGCGAAGCGGTTCGGAATGCCACGAGTCTGGGTCAGTGACCAATGAACCCATTTCAAAAA
CGTGGTCATGAAGGCGCTAGCCCACAAGTTCAAGGTCCATCATGACCTAACCTTGGCCTACTGCCCCTGGCGCAATGGAACGGTTGAGCGGATGAACCGC
GACATCCTCCAAGTGATGCGGGTCATGTTGCGAGAGTACCAGCTAGCCGAACAAGAATGGGACTACCTATTGCCAGTGGTCCAAACCAACCTCAACCAAA
CACCGGCTGCATCACTGGCGAGC