Description :
From Genome Similarity Track
Location :
Scaffold_41:251713- 253930
Sequence
2217 bases(100 bases per row)
AAGGCCAGCGCGTGAGCGTAGTCCGTCAATTCCAGATCTGTTCCACTACGCTCAAAGGCGTTGGTCGTACCATCGTCAACATCATCCTCTTGCTCGTCTT
CAGTCGCGGCGATAGCCAAGTAGTGTTGTCTTAGAGTTTCCGTTGGGTCTCTCGTTGAGTTGCACTCGTCATCTCCAGCTTGTCCTAAACCGTAGTCAAT
TCCGCCGGGGTCGAACACCGTCGCCGCTGAGTTCGTCACTCCGACCTCAGCTATAGTACCTTCCAACAGTGGTACCTCTGGTAATTCATGGTTGTCGGTT
GCGTCAGGGCCCGTATTCGCTGAGCTCACTGCGATGGTCGATCTGACTCCTGCGTTTTCAAACTTGGCTCCGAGGTAGATGGCATCATCGTCACGCTGTC
TAACCACTTCCAGACCGATCGTAGTCTCCATAGTCTCCAACGCTGAGTTCGCAGTAGATGGGTCGTTGTTCGGCTTTATTCCTTCAGACAGTAATACCTC
CCGACTATCATAGTCCTTGGTCGCGTCGGAGTGATCAACCGCTGAGTTGGTTGTGACGGCAGAACTAACTTCCGTGCATGCAAACGCGTCCTCGGTATAG
CTGACATCATGACAACATGTTGTGGCCACGTCCGGGGCACTCTCAGTATTTATATCTGCTGATGCCGAGCTCACTGCCCCCGACTTGATAATGCAGGCTT
CCGGTGTACCCATCGCTGAGCTCACCACGGCTGCAGAACTTGGTCTACTGACTCCAAACTTGGCTCGGTTGTCAGCAACAAGTTGGGCATCACTTAGGGC
GCGTTTTGAGCGTTCGTCAAGATCTCCTTCCGTTATAGCTGAGTCTTCGGTCGCCGACACGTCTTCCGTGGCCCTTACTTCACTTTTTCCTTCAGCCGCT
GAGTTCGTGTTGACGTCAGAAATGGCGCCATCGTCTTCAAACTTGGACAGCTGATAGGAGACATCTTGGCCATCGTGTATCACCGACGTACGGTCCGCTC
GGACGTCTTCCAGCTTGAACGCTGAGTTTATAGCCGGGTCACCCCTTGTCACCCCTGAAGTCGATATGACGTCTGCGTTACCGCGACGCCTCTCGTAGTC
GCCGGCTTCAGTGTCGGCTTCGATCCTTCTCCAGCGTTCGGCGCATGTTAACTCTGGTCCACTTTCCACTGGAGGAGGTCGTCTTTCCACCGCCGTCGGA
GTTGGGTATTTTCGTCTTTCCACAGCTGGCGGCTGGTGTGACAGCCAGTCGTCGTACAGTCGTTGTTCTTTCTGCAGCAAATCTTTATCCATCGCCGACT
CAAAGGCCAATATCTGCCAGTCACGGTACTTCGCCGAGTTCACGCGGACATATCCCTCGTTGGCCAGCACTCCGTGTGGTTGCCATTTTATCACATAAAA
GTGAGGTGGGCACCAGACTGACGTCTGTCGTACGTTCGTAATCAGGACATGGGTTGGTCTTCCTCGGCGATTAAAAACAACCGTTGGAATCCAACCCTTC
GTCCGTCGCACCCATAGGTCATGCGTCGACTCACTGGGTTGTCGCCTGGGTAATTTGAACTCAGCGGTCATTCGACTTTCGATCGTCAACCCGTCTGGTG
GCCCGCATGGTACATTTGGTCCGAACTCGGTCTTGGTCGGTGCATTACTTGACCGGATGAGTGGTATCACCATCTCATCGGGTAGCTTGACCGCCGAGTT
GTACAGATCCAGACGTATTCCAGCTGGGATCATAAAGTCGGTGCCGAGAATCAAATCGACTCCGGCATGATGAGGCATTATCCATACTTCAAACTCGTAT
GCCACTTTCCCAGCCCGAGTGTCACCTTTCACCACTGCTCTTGACGTTGTCACCATCCTGTCTTTACTTATTCCTTGTATGTCAATTCGCTTATCTCGGC
TGGCCACTCTCTTGAGACGCAGTTTCCTCGCGAAGTACTCACTGATCGCCGAGACATTTGCTCCGGTATCCAATAATATCTTGGTCCTTCGGTCATTCAC
TGCACCCAATACGAGGGCTCTCATTCTAACTCGGCGATCAAACGTCTGTGCTGACCACCATCCCAGCCGTTCTCCCGGAAGCAGCTTCATTATCCTGGTA
CGATGCACAGTCTGGTCTGACTGCCGAGTTACACTTGCAATCGCTCGGTTGTTATCATCTAGCTCACCGAGCTCACGTTCAATTCCGTCGATTTCACACA
TCCAATTGCCATCCCCG