Description :
From Genome Similarity Track
Location :
Scaffold_1301:2517- 10161
Transcript NameFunction/comments
Phypl_g13045hypothetical protein PHYSODRAFT_353499
Phypl_g13046conserved hypothetical protein
Phypl_g13047hypothetical protein
Phypl_g13048cysteine protease family C01A, putative
Phypl_g13049cysteine protease family C01A, putative

Sequence
7644 bases(100 bases per row)
AGCTTCCATATTTTTTTTCACAAtaaccagcagcagcatcacgatCGGCCAACGCCCCCGTCACAACGCCTTCCGCCTGCAACGCCAAGCGGCCCGCTGA
CCAGCGCGCCTCACCCGCACGTACGCGCTCTCTGACTCCAGCCACGAGCTAATagcagcgccatcgacgccgagctAGCCGAGTTTGGCCAAGGTGGCCC
CACGACAGCGCGAAAAACAAGAAAGAAACGCCAAGCAACGGGCGAGGAAAGGCACGGAAAGCCCGCTGGAATACCGGAGGAAGGCACGCACAAAGCGTTC
GCCTCGGTCCACGTCGCCTCGGACGCTAACGGCCTTCAGAGGCGAATAAGACaaagcgctgctgcggaaggTTGATCACTCAGTTGTCAATCGACCGGGA
GGAGAGAGAGCGCTGCCGATCGCTGCGTCCCTTGCTGCTAACATGACAGACCGGGTGCTGTCTTCACTGATGGCGGGTGCCGCTGGGTATACGGAGGCtc
agctcgtggtgctggtgctgagcgtcgtggtggtggccgtggcgctgctgtcctACTTCGTGGTCGCGCCCGAGTACGAGAAGCACCTAGACAAGCAGTA
CGCGGCCATGGTGCACGCCTCGTCggagcgccagctgcagaacCAACaggcgcacgagctgctgctcgcgcggatcaagctgcgcaagcacaaGTCGCTC
GGCGCCTGGGACATCGAGTCTggctccagcgacgacgacggactgggccgctgcacgctgcagcgacggcatTCGCACATGCGTCCGCCGCCAACCAGCG
TCTCTTGGCCGCAGGACCTGGTCTCCGAAGCGGCTCAGATCGCCCGGAGGGAACGCAACGCCAGGCGTCGcaagagcgagagcgacgcgctcaagcaaGC
CAACATCCAGCGAGCGGACAtgctgcgtcgtcgagtgctgcTACGaaagctcgaggaggagatcgctGGCACGGTGAAAGCGAACGAGGAAGCCCAGGCA
GCCGCGACGTCTGGCAACGCCAACCCGACGCTGGCCAATATGCGACGGCTCTCGGGCAACACACTGGATCTGAGCGACGGTCGACTCAAGATGCTACAGG
AACATCCTGCTGActgcgtcgaggagctcacaGTACTTGCCCGAGCACAGTCGCCGCTggcttcgtcgccgctggtAGAGAATAATACTGCCATGACCAA
GGGCAAGGTCGCGACCGTGCCGGACCTCCACGAAATAAAGCGAGCGCTGAGAGttctgcacgacgtgctgagcttctACCTGTCAGTGGACCACCGCGAC
ATGAACAAGCTCACGGTGTTCTgcaactcgctgctgcagcacgacggcctcAACCGACTGCGTGCATTTGAAGCATCCCGCGATCAGGATGTGCGAGCGC
TGTCCAACTCCATCATCGAGAAGGCTGTGCCTGCCATTTGGCACTAAGCGAGTCGCCCTTCCTACCTACCTATCTATAAATCCCCGCTTCCGACTCATGT
AGAGCTGCCGCAGTGCACCCCTGAACCAGTAAATAAGTAAATAGCTCCGTCGGAAGCATACCCATGAATAACTACAATCCCATTTGCCTCTGTGAGCACC
CTTTCAAGCTCAAAAATGGGTCGTACTCAATGACACTGTTAGATGACTCTCGTACTTGCACGTGTGGCCACCTATTTCTTCTGGTACGACGCCGCGATCT
CTCGTAgcgagctcgacagcagcgtccgGAGCAACAAGCGGGAAATGGATCCGCcgcagagcagcacgctgccggcCGTGGACGGCGTGAGCTTGGAGTT
CCAGAGGATGAGCGTCTTGGGGTGCGAGGGGGGGGCCGTCCTGTCGGCCACGAactgcacgagcgccacgtggtcgctcagcagcagcgggccGCTCTTC
TTGATGCTGTAGCGCACCGTGGGGATCCGGTCCGAGTCGTCGGGCGGCCCCGCCGAGAGAATCTGCTCCTCGACGCCCAGCGAgacgaggcggcggtggc
ctACGAGTCCGCGACCCTCGCCAGGCTTCAGCGTCGAGCCGCGGCCGACCCACTCCATGCGCAGCCACGAGTCGTACGCATCGTCCACCGATGCATTcac
gagctgcgtcagcgcgagctcctgtccgtcgctgtcctcgtaCGCCTCAAggccggcagcgtcgacgtaCCGATCCGCCATGATCAATGGGAAGAAGTGA
TCGAGGGATTGGTTGAAATAGGGATGATAGGACGATATGGTTGGTGGTTATTCCGTGGTTGAAGAGATTCAATTACAGCGAATGAGTGGAAAGTACCAAG
TATCTTTCCGCGCGCACGTACACTTGACGCGAGTGTGCGCCACTGGATCTGTTGCCGGTCTGTATCGTTCCAAGCTGCTTCGAGCACCTCAAACCAGATT
CGACAGCCAGATTGAACGTGGATCTACTTGTGTTTGCCTACCAAAAATGGCGCTATGTAGCTCTACTCCAGGTGTTGGTCTGCTCTGAccgcagcacttg
ctgccaGCGTGCTGAGGATGccctgcagcgacgagcgcagGATGAACTTGGCGAACccgccgcagcagagcagATATCCAAGTATCGACGGCTCCATCTT
GAGCGACCAGATCACGAGCGTCGCTGGCGTGCtctccgacgacgccgcgacgtccacgaactgcacGAACGCGAGGTGGTTCTGGGCCGGGAACAGCCCG
AACTTGTGGACCTTGTAGCAGATGGAGGGGATCTTGGAGCGGTcccgtcgagcagcagcgagactCGGGCGTCCGCCATCGCTGTCCACCGGATCGTCAA
TGGGCAGTCCGGCCGACAGAATCTCCTCTTCGATGCCCAATGGGGCTCCTCGTACGTAGCCGACGTAGCCGCGACCTACGccctcgtgcagctcggagCC
CCCAGCCAGCCACACTTCCTCCAGCCACGCGTCGAACACCTCGGAGGGGGAGCCGACGACACACTCGGacaccaccagctcctggccCTTGTGTCGCTGG
TAGTCCTCGAAGGCCTGCGCGTCCGCATACCGCGTCGAGTCCAAGTGGCTGCGGCGCATTCTCCTTTCAGGGCTCGGTGGCAAGAGAAGAACTCATTTGT
TGATCCGGATATTCAGCCAATAGAAATGACTGTTTCCTACATGGAGCCTGTGGGGCATGCCGGCATAGCTGCCCTCTGTGGTGGCATTATTAGAGCTCCA
GTAACTCATACAGAACGTACTTGCTGGCTGCTCCGTTGCCTTCTTGGCTATTAGACCGAAGGAATGTCTTCAACGTAGTGCGGAAGACCAGCCGGACAAA
ACCACCGCAATGCAGCTGGTTGCACGCGCTCGACATCTCCGTCTTGACCGTCCACACCATGAGCGCCGTAGGCGTCTTGTCCGCCAGGCTTGTCACCACC
CCGGGGTCAGACGCTGCGTCGATAAAGCGCGCCATGGCGAGGTGATTTTCCAGGGGGAAGGGACCAGGTTTGTGTACTCACTGATGGGATCCTGGGACTC
TCACCTCGGTCTCCTGTTGGCGCATCGGAAAGTCCTGCTGACAGAATCTCTTCTTCCCCACGTAGCGGCCCGCGTCGCACACTTCCGACGTATCCCCGAC
CGACGCCTTTGTGCACTTGGTCCCCGCCAACAAGCGAATCCACCCATCGAAAACTTCAGGGGGGGGTTCCCGATACAAGTTCGGACACCGCGAACTCCTG
ACCAGCATTGGCCTCGTACGCCTCCAAGCCGAGGACAtcggtacatgtaccagtaGCAGACAACTGCGCCATCGGTGGCGAGCTCTTCTAGTTTTATTCG
GATAGCCTATCCATTTAGGATTGTGATCCAACTGTCAGTCTGCAGAATGAGACCACTGAAAGCTCTGCAGGTACGTGTAGGTAGGGTGATTGATCTATTT
AGCTTTACTTCGCACTTCATGAACTTCCCAGCTACGGGTATAATTTACAGCGTCTCCTTGAAAGCACTGCGCTGGCGACTGGCGTAGATGACACCGATCA
CCGTCAGGAAAAGAGTCACCACGCCAACTGCGATGCCTAGGACAAGCCAGCTGTTAGGCGACATTCCGACGAACTcgacagcgccaccgccatcGACCAC
CGTGTGTGCGGGACCGGCTAACGCTCCCGTAGGGATGACGGGGAAAACACTGAGCCCGCAATTGATTTTCGAGTCCATGGCAAGCCGCAGAAAACCTTTC
TCCCCCCATGACGACCCATACGAGTTCTTGAGAATCCAATAGTCTGTGGTCCCGTCCGAGTCATAACCGACCAGCACGATCGCGTGGTTTATATCTCCGC
TGGAAGCAAAGTCTCCGTCGTTCGGGCACGTGTAAATACCGCCTTTGTACTCGTCAAAGGAGCCGCCAGAGTTGATGGCCACCGAAAtaggctgctgctg
caatgcaatcttgagcagctcagTCGAGTCGCTGGTTTGATCGCACGAAGGCCCCACGACTTGCTCCCAACCAGAAatgctggcagcagcgtcatccGTC
GACGAGTTGTCGCAAGCATTCGTGAGAGTAGCGGTGGATGCCTGCGATGTATCCTCTTCGTTGTAAGGCAGGTCCAATTGGCTCAATAGCGACCAGTGCA
AttgcgcagcgtcggcgAAGGCAGCGTGGGTCATGCCTCCGTTGCAGCCGTTGTTCTTTGAGCCCCAGATCATCTTGGTCTGCAGCCAGCTCGATCCGTC
CACGCCTCCCTCAGCCCAGCAGTAGTCGAACGTGGCCGTCATCTCCCTTGAGCTGCATTCCAAGAATTGCTGCGGCGACAATGAATGCGGGGTCGCTCCT
GCACtcaccgccaccgccgtctcGATGatatctgctgctgcaaaggCCCAGCAACTTCCACACTGGTTCTGACTCTTGACATCGGTGCAGATACTCTGGT
TGTGCGAATTGTCCGTCGAGCACCAGTCCAGCGTCTCACGATATTGAAGCGAAGAGTTGGCGAGTATGCGCTGCTCCGACAGTCTGCGTGCCTGTTGTCG
CTGCGCCGCACGatgctcctgctgcacaaAATCCGCAGGCGACAAGGCCCGGCTGCCTTCATGGTACAAATGCCGCGAGTTGACGCCCATGGTGTACGAG
AAGGCCCAGTCCCGCCCGGCCGCGTGGTTGTGCACTTGCTCCAGGTAGTCCACGTGAGCCTCCATCCTGCGCCGGAACTCGCTCGGGCCTGCGTCCATCC
CTTCGTCTTGCAGAAACTGCGTCACCATCGCGTCCGAGGGCTCCGCGACGCCATCCCGGCCCGCCCACAGACACCGCGCGTCGCCGCaactcagcagcgt
gccAAAGGTGGAAGGGTCTTGCGCCTGTGTCATCGAcggagcggcggcggccgccgccagcagcgcgagcaacTTGTTCCACGACGTTACCATTTTCATT
CTCGCTTGACCTACTGGCCTCCGCGTGCTATCACCAGTTGGCAAACCGCTTGGGGGCGACGCAAGTGGAGCCGCTTCGGCAGATGAATTGTGATGGAGCG
TTTGATTGCGGCAAACTCACGACCATACAAACTTCAAGATGTCGTGAGTCAGCCGACCGATTGTTTCAATTCGCCCTCGCTCGCTTGCGGTGGGGCTACG
ATGGACTCGGCTGGCGCAGCCAGCAACCGCCATGGGTTGCTTTCATTGATGACCTTGATGGCCTGTTCTCTAGCGTATAATTGGCGTTGCTGGGACGTGG
GGCACTTGTCGAACGATCCCACGCCGCCCGTGGGACGCCGCTGGTGTCGATGAAGTTGAAAGCACCCCGCAATGTTGCACGCGCTGTCGCGAGACACAGT
CCGGCGTCTGGATTCTCACGAGCGCATGAAAGCACTGGTAAACAGCCTGGTTATGCCTTTGGAATAGAGTGCAAGTTGCACTGCAGCCGCTGTTCTGGCA
TCGTTCACTTTTGCATTTTTTGTAGTCGTCGAGACACAAGTTGCCTTGCACTTGCGAACCAGAGCTCATATTCGCAACATGGTATATTACCCTCATCAAC
TCGAGGTCTTTTCGTCCTAATACCCGCTCTGGGCATTCGTGGGGGTCTGGACAGCGTACATGGCCGAGttctgcttgcgcagcaccttgagcttcCGTTG
TGAGACCACAATACCGATCGCCGTCGTGACCAGCGTGAAAATGGTGGTTGCAGCCGCCACACCGATCCACGCCGTTGGGCTAAGACCCACGAAGACCTTA
TCTCCACCGCTATCTACGGACGTGCTCGCCTGGGCGCCGGCCTTCGCGCCGGTAGGAATCACGGGGAAGACATTCAAGCCGCAGTTAATTTTGgcgtccg
ccaccagcttgaTGAAGCCGCTGTCGCCCCACGAGCTGCCGTACGAGTTCTTGAGGATCCAGTAGTCACCGACCGACGATTCCGTGCCATAACCCACGAG
CAGGAGGGCGTGATTCAGGTCGTTCTTGGACGCTATGTCGCCATTGTTTGGACAATTGTAGAACCCGCCGGTGTACTCACCAAAGCCGCCGTTAGAGGTA
ATTGCTACAGCAATGGGCTGCTTCTCTAGTGCCGAGCGGAGTAACGTAGTGCAGTTCTTGGAGGCGGTACAGTCACCACCCACGATCTGCTCCCAACCAG
TGATGCTCGCAGCCGCTTTATCCGCACTAACAGCGCACACGGACGAAGAGTTCGATGCCGACGAGCTTCCGGAACTGGAGTCGTCGTACGGCATCGTGAG
CTCGGTCACAAGACCCCAGCCGTTCTGAGCAGCATCCATGAAGGCGCCGTGGGTCATGCCACCATTGCAACCACTATTTTGTGACTCCCACTTGATCTCC
GGCTGCACCCAGCTGGCACCGTCCACTCCGCCATCCGAAGCCCAGCAATACTCGAACGTTTGAGTAGTTTGAAGCGTACTACACGtcaggaactgctgcg
gAGACAAGGAGACGGCCGCCGAGGCGTTTTCCGCGATCGCCACGGCCGTCTCGATcgcgtctgcagcaacgaACGACCAACAACTTCCGCAGCTCTTTTG
GCTTTTCACTGGTGAGCACACGCTGTGGCCCACGGCGTTGTCTGTGTCGCACCAGTTCCAGTATTCTGAGCTTCCCGAACTCgagatcgtgctgctgctg
ttggtacTGTTTGCttgctggagacggcgagAGTAAGCTGAGACCACTTCCTGATCCACGAACTGCTCTGGCGTCACTTTGCGGATAGGCGACGAGGTCA
AGTGGCGTTCGTTCACACCCATGTGATACGAGAATGCGTGGCCAACTTGCTTCGCGTACATGTTCACATCTGCGTGGCCGCAAGAACAACTCGTGTTAGT
ATGACGCAATGAACTCGCCAATGAACGTCTGCCGTCTCACCTTCGATGTACGTCATGTGCTCCTGCAAGTTGCGTCCGTACGACTCCCTGTCGCTGTAAG
TCACGTAGTTGCGCTCGATGAAAAGCTCGCGCAGTGTTCGCGAATCAACGACGTGGCCATTCTCTCCGGCCCATAGGCACGCCGAGTCTGCAGAGCGAAC
AGTAGGACAGCCCACGAGAGAACCCAGTGATCTGTCCGTGGTCTGAACCGCGGCAGCGTTAGCAAATACCACCGCCGAGAGCGTGAAGCTGagagctcga
agctgcatGATACTCTTGACACGCCTGTGCCCGAGGTGGCAAAT