Description :
From Genome Similarity Track
Location :
Scaffold_1:2516161- 2524769
Transcript NameFunction/comments
Phyin_T30-4PITG_00482Putative uncharacterized protein
Phyin_T30-4PITG_00483Pumilio-like mating protein M90
Phyin_T30-4PITG_00484Putative uncharacterized protein
Phyin_T30-4PITG_00485Putative uncharacterized protein

Sequence
8608 bases(100 bases per row)
TGACAGCTTCATCTCCATCACACATCTCCAGTCGATACCGAGAAAGGCATGAGCGACGTGCAATCGCTCAGTGATTCGCCATCGTCGTCCGTAGGGCTTG
GCAATTCGCTTATGTGGGAGAAGGTTGCACTGTCGCCACTGGAATTGTTGTCGGTGCAGCTGGAGCATGAGCTACAGCACGCTGAGGAGGTGGCCGCAGC
ATCTGCTAATGGCAAACAGAACAAGAACGGAGTGGATGTGAACGCCAACACTGGCAAAGCTGCAGGACGCGTAATCATCGAAGTACTTGCAGCCAAGGAT
CTGGCTCTAGATAAGAACGCAGCAGTGCAGGCGGTCAGTGTCAATGCGCAGCCGGAGCTGTACGTGTCCACGCAAGTGACTCCGCTATCAGCGTTCGAGA
AAACCGCGAAGAAGCACTTGCGCACTAGCAGCGTTCCAGCTGTAGATAACGCAACAGCTAGCTGGAAAGAGTCGTTGGTGTATGAAGGCGCTAAGACCAA
GAAATTCGGCGTGAAGATCTCGCTGAGCTGCAACGCTGAGGTCATTGCAGATGTGGTTCTCGGAGAGCTGGAGCTTCGCAGCGCCGATTACGAGGACCAA
ATGCCGCAGGAAAAGTGGTTCGACTTGACTGCACCAGCGTCTTCCGCAAGTAGTGGCGTTACTGGTAAGCTGCTGCTGCGCCTCACGTTCGAGTACTCTG
AGCGCAAGCGCCATGAACGTCAGGTGGCTTTGCTTCGACAAAATAAACGTGAGAATGATGACGATATCGAGCGATACAAAACTACGGCGCGATTGGTGAA
TGCACCTGTGCGACACCCTGCTGCGTTTGGCAAGGAAACTGCACGAGCAGCGCTTTACTTGCCAGGCAACAAATTTCACATTGATGCATACCACCCGGCT
GCGGTCAGTGTGGCACCTCTCCCGGACAAGACTCGCATTGTGACTCCGTTTGGGCGCGGCGTGGTGGTGTCCTTCCGGCCAGAGACGAAGATGTATGTGG
TGCAGATGGACACGGATGCTGCGTCGAAGAACCACACGATTGCCTACTTGCGCCAGCATGTCGTGAAGGAAGAGTCTGAAGAGCCACACCTTCGTATGCA
CATGAAGGTGTCGACTCCGTACGGCCTGGGTGTGCTAGAGGAGATCCGCCCCCACGACGACGTTTTGATCGTCAAAACCGACTATGCTCACATGTTCATG
CAGCGTAAGGACGTCAAGCTACCAGTGAAGGACATCTCGGAGATGACGACGAAGGATCTGATAAGCGAAGCCACCAAGCTCGCGGACGCTGGTAACGAGG
AGTTTCGTGAGGGTAAGCTTCAGGATGCCGTGTACAGCTACCTGCGCTCGCTAGGTTTCCTTCAGCGTGTGGACCAGGACAACGCCACACACAAGGAGAA
GGCAACCATCATTCAGACCATGATCCGCTGCCACCTCAACATTGGCGCGTGCAAGTTGAAGCTAGACATGTACACGGACGCCGAGATCGCGTGCACCAAC
GCCCTAAGTATTCTCACGGTGCTGGCCGATAACCGCGAGGGCAACGTTGTCACATGGATGGGACGTCTGGGCATGTCGGAGCAGCTCATGTTCGAGGACT
GGCCCTCCAAGGCGCGCTTCCGGCGCGCACAGGCGTGTGTGAAGCTGGAAAAGTACGTAGACGCCAAGCACGATCTGCTGCTGGCGGTGAAGTTGAACCC
TCGGGATAAGTCGTGCCGCACTTTACTGGAAAGGGTGAACAAGCTGGTGGACAAGCAGAAGCGCGACGAGAAGAAGGCTTGGGGCGGTATTTTTGACAGT
CTCGAGGCATCCTCGTCGACCTTCGAAACCGTGACAACCAAGACGACTGCCAAGACGACGACTAGCAAGAGCGGCAGCAGCGAGGAGAAATCCATTTTCA
CGCGCAAGTCCAAGAAGAAGCAGGAGACTGCAGTAACTACTGCGAGCGAGGGCGAGCCCTGGTACATGTACTTGACCACGCGAGCATTGGCCACAGCCTC
GGTGGTGACGGCTGGCGTGGCTGCCGTGGCACTGCTGGCGCTGAAGCCGAAGAGCTCTTAAGCAGCGACTTGGTGTGCAGGTGTTTCTTGTTGCCACTTC
AACTTCGGGTGCTGGCTCTCTGGCTGGCTGGCGTCTGAGTCGAGCGACGGTGCTATCGTCTCCAGTGGGCTTCGGCAGCAGGGCGCACTTTCAATCAGAG
AAGTCAGCAGCTGCGACTGGGACAGGGGATCGCACGATGTGTGGACGTGAGCGCTCCGAGGACCGTCCTTGACGCTCTGCGCCGCCGTATAACTCGCGTC
CACTCGCTTTAACACCAGCGATGCAAATACACGACAGAAGGTTTGGTCCTTGTTGAAAGAGTGGGTATCTGCTAGCGGCAATGTTTCCTTTTGCAACCTA
AAGCAGCACAGCAGTATGCAATGGCAAAAAAGCGAAAGGGGAGGGCAATACGGAGACTGACGTAGGTTGGTTGCCTTTGCTGCCTGCGTTCGATCCGATC
TCGCATGCGCCGATGGAGCCACCTTCACCGGCTTGCCTGTCTATTTCGACGCCTTCCACGAGCCTGGCAGCGGCCTTCCATCGCCCGAACAGTCATAGCC
GCCGCGTTGTGATCCCGTTGTTTTGCCTGTCACCAAGATGTGTAGTTGCCGAGTGGCAAGCGCCAGCTGGTGTTTGCGGCAACTTGCCTCTAGCCGGAGT
GATGGTCACTGCCCCTTCTTGGAACGCGTGTCGACGATCCCAGGCTGTCCCGCGTCGCTTCAACTTTGCCGTTAGCATAACGCACGGCTTCCACCCTTTC
TTCCGACCCCGCTATCGACCGAGGAAACCCCAGGCAATCTGTTGGCAACAGCAGTGCATACAGCTAGCTAGTAACGACCGCTCCAGTCAAGTCACATCAC
ACCTCGACACATGCGTGCTCCGGATTTTTCCATGAAAGGCAACCTCGAGCTAACTGCCTCTGCGGTGAACCGCATGCATGACGACGGAGCAATATGAAAT
TTCCGATGCGAGAAGACCACCGCCCGTGGTAGGATGGCAGCGCCATCTACCGCCTACGGGGCTCCTTGTTTGCTCGAAGGGGTCAGTCCCACAGTTTTGA
GCAGTCATGTTACACACTCGCCATCTCAGACGCGCCGACACGGGCGCGTCCGTTGAAAATTCGCGGCGCGAGATGGTTTTCAGCATTCAATTGCAAGTTG
CAATCTCTGGCAAGCCATTGCTAAACCCACCCTCAGCTTCGTTGAGGGTTTCCGTCTTTTTGCACGCCGGCGTGGGTGGGTCCTTTCGCTTTAAGTGAAC
GCGGCAACCTGTCACATAGCCCGTTTCGCGAAATAACCTCCGACCCACCCGCCCGCATGCACAGCGGCATCATTCTCCAATTTGCCGTCTCCTGCTCAAG
CGGACGACTGCCGATCTGGAGAGGTTTCAGCGGCACTCGACACCCAGCAACCGCCCACACTCCATGGGTCACAGCAACTCGATGAGCCCTGTTAAGAGCG
GCAGCGGCGGTGGTCCTTCCCCCATCACGCCACCACAGCGCGACGGCAACCACGCTGGGGTCGACCTGGCGATGCTGGAGAAACCCGTCCACCACGACAA
CCCTGTCGAACCAGTGCGCGTGAAGCTGCAGGACCCTGTGGGGTACCCTTCGGACACGCTATGGTCCTCGGAAGGCCTCAAGTCGAGATCGTCGCTGCTT
TTCTCCGCCTCGCAGGTGCTGAGCGAGCGACCGGCCAGCTTCGCGCTGCGTGCTCCGCGGCTGCAGTCCAAGACGGACTCGCGCTCCGTGCACAGTGCTC
AGACCACGCCGCCTAGCGAGTCGGATGAAGGCGAGGCAGCGGTGGACAACCAGAAGGAAGACGAAGGTCAACGCGACGCCTCATCTGAGAACGCCGGAAA
GCTGCCGACATCATGGGGAACGACAACACAGAAACGCTCAAGCAAGGTACTTGTTTCTTTTCTCTTGGGCTTTGCGAGCCAATGACTCTAATGCGATGGG
TTCTCCTATCTGCTTGTGCAGGAAAATCAACCGACGGACAACCAAGAGCCTGAGTCGCATGTGCTGTCGCTAAACCTGGTACGTTTCGGTTGGAATCCCC
TCGTTGGGTTGAAACAGCTTTAAGCTTACGGTTTTCTTCTACCTCTAGCAGCTGCATGACCACGACAAAGCTCCTCTGTCTCGAAGCAATGATCCCCGCG
CTGTGGATATCTGGACGAACCCTCACAACAATTTTGAGGATGGAGACATCGCGTCAGCGGTGAGCCCTACGACGTCGCCGATCAAGCGAAGTTTTCCACG
CTCCAGTGCTGCCACCTCGAGGCCTATCCCAAATCGATCGTCTCGTGGTGACAGCACGACTGCGGGCTGCCGAGTCCCTCCTGGACTGTCCTTGATCGAT
CGAATTCAGGAGGACTTCCCCCGTACGCCGTCACCTGAGTACGGGCAATTTGAGGGCGATGGTTTGCCTGCTCGCAGACCTTCGTTTGGCGGAAGAGACC
AGCACAGGCAGTCAATGTTCGGAATCGACGAAGGAATGGGGCAGCTTAGACTGGGTAATTATCACTCAGCTTTGCCCTACGATTCTGTCCGTCGTTCTGG
CCACGATTTTGAGGATGTACCTCGGATGCCGCATCACGCTGCGAACCCCAGACTTGCTGGAATGAACGGCCACCGACACCAATTCGGTAGGAGCACAAGC
GAGCCTCCTTTTGGTGAGTCTTACGACGGAGCTATGGCACAAGGCTATGCGTCGCCGTATGCCACGAGTGGTCAAGGCATCCAGGGCTACCCTATCATGA
TGAGTGCTGGCAAGTCACGATGGGCTGCCAACGAGGACGGGCACTCGTTTACAGCGTCGCCTTTCGGGTTTGTGCCAGCGGACGTCGCAACTTTGCACCC
TAGTTACAACCCTGCCATGTCTGGTTTCCCTGTGGGCTATGCTGGCGAATACCGCGGTATGAAGCCCGCCGACAAGATGTTCAAAGCTCGCCCAACGTAT
CCCGTAGCTGACCATTTGGTGTACGAGCGTCACGACTTTGGAGGGTACGCGCCTCGTCCGCAGATGCTGCACCGATCCAAGGTCGGAGCGCCTCGCCGAA
GCGAATTCGAGTACTTTCACCCGATCGCTCACTCGTACTCGTCCAACAGTCTGCTGGAGGAGTTCAACGCGGCGCCCAAGTCGGAGAAATGGGGATTGTC
CGCCATCAAAGGGCACCTCTTCCTCTTCGCGAAAGACCAGACAGGTTCGCGATTCATCCAGCAGAAGCTGGAGAAGGCAGACGAACGTGTCAAGGCTGAC
GCGTTCAACGAGATCTTCCCGAACTCGCTCTTGTTGATGACGGACGTGTTCGGTAACTACGTGATCCAGAAGTTCCTCGAGTATGGATCACTGGAGCAGC
AGCAGCTGCTGGTAGAGTTGATGACTAGCAACATGATCAGTCTGGCCCTGCAAGTATACGGATGCCGAGTGATTCAGCGTGCTCTGGAGGTGACTCAAGT
TGAAGAGCAACTCGCGCTGATCCGACAGCTCAAGGGCCACGTGATGAAGTGTGTCACTGACCAGAACGGCAACCACGTGCTTCAAAAATGTATTGAGGCG
GCATCCTGGAAGAGAGCGGCTGAGTGCAAGGGACTGAGACCCCAGCGTTTCGTCACGGGGGAGGACATCCAGTTCATCATCGACAGCTTCGTCGGCCAAG
CTGCATCTCTCTCTACTCACTCATACGGCTGCCGCGTGATCCAGCGCGTACTGGAACACTGCGCGCCGAATCAAATCCGGCCGCTGCTGGATGAGATTAT
TTACAAGTGCCGCGACCTTGTCAAAGACCAGTTTGGGAACTACGTCGTGCAACACGTTATCAGCCACGGCGAGCCGGATCAGCGCAACATCGTCATGCAA
GCAGTGCTTCCTGAGATCGCTCGCTGGAGCCAGCACAAGTACGCCAGCAACGTCGTGGAATCCTGCTTGGAGCATGCGACGAAGGAAGAGATCAGCCAGA
TCGTTGACTTCATTCTTCAGTGTGACGAAAGCGGCGCGTCCTGTGCTCTACTTCCCATGATGAAACACATGTACGGCAACTACGTGGTGCAGAAATTGCT
GGAGCGTGCGGATGACCACGACCGCCATCGCATAATATGTATTATTCGACACAACGAGGACTATTTGAAGCGCTTCACATTTGGGAAGCACGTTTTGAGC
CGGCTGGAGCGCGAGGAGCAGGCGACCTACTATTGAGTAGACGGCTCTGGAGACCACCCCACTACTGCAACTACCGGCTCTGATGCAGGCGGAGCCCAAC
ACAGCAGTCTTCACGATGCTCCTGCGCTTCCTGCCCGCCTACACTACCTATATAAATATTTTGCGGCGTAACGACAAGCTGATCGTTCAACACGCGCCGG
TTTGAGTTCAAGACAAGCTGCAGCCACAGCATTATGACAGAAACCAAGTTTGAGCGTACGATACACGGGCCATCACCAAAAATTAATAAACAGGTTCAAT
CAATTGGTTCCATTTTGAATTGAAGGCTTTTTTCCCCACTCAGCATTCCCGTAATATTTCTTCTATGCCAACATAGCAATCTCTTTAGCTATCATCTACA
ACTCCTGCAGCGCACGCGTCACCTGCTCCGACGCGCGTGCTCCGGTGTCGACGGCGGCATGCACCGACATGCCGGGCTGCTCAAAAGCTGTCGCTTCACC
GGCGAAGAAGATGCGGCCGGCCACAGGCGCAGCCAGATCGTATGACGCCGTGTCGGACTGGCCCACGCGAGGGAAAGCGTAGCCTCCGCGGATCCATGGC
TCGTCACCCCAATCCTTGTACGTTCCCTTGACGTAGTATTTCCGCGCAGGAGACGGCTCGTCCACGGTGCCATAAATCATATCGAGTTGGTCGAGAAAGC
CTTCAATAATCTTCTTGTGATCCACGGCGACAAATTTCTCCGCGTACAACGCACCGGCGTATCCCGTGATGAGGTACTGCGCCTCACTACCCTTGGTCTC
CATGTCAGCACACAGCTCGTCGCCATTGGACTTCAAGTGGCCAATACCCTGCGTGCTGTTGATCCAGAACTCGGGCAAGAAGCAATCGGAGCATACAACA
CCGTGTGCGTCCTCGGGCCAGAAGCGACCGGACATGTGCAGCAGCACTTTGCCTGCACGACGCATGTCAAAAGATGCCACAGCATCGATTTTCTCCTGAG
GCAACACCGGGATGTAGGCGATCTTCGAGAACACGGCAGTCGACACAGTCACAACCAGTGTGCGGCATGAGATCTGCTTGCCCTCTGTGTTGGTCACAAT
GACGTGGTCGTTCCGTGAGTAGTCTACGCTAGCAACAGGCCAGTTGAGACGCGTTGTCACGCCATTGGCGAAGTGATCAACGAAGCGCATAAAGCTCGGC
ACTACGCGGTAGTCGCCTTCGTCTTCGAGCTCAATCCACTGTTTCTCGTAACGACATGTAATGCGCATGGAAATGTCTTCCAAGGGCCCACCCGCCGTGT
TAGCATACCCAGCCTCACACAGCTTCATCATGGATGGAGATAGATCCATCTCGTTGAAATAATCCCGCATAGACTTTTGAGGCGGGATCTGATCAATGTT
CTCTAAGTCGCTTAAGTCGGACACGGAGTCGTTAAACTTGACGAACTCCTCGTCTTCATCGTCGTACTTAAGCATGCGTTTTTGGTCACCGATGTAGTAA
TAGCCGATGCCTCCATCTGGAGCTGCCTCAGTCGGACCGCCATCGCCCTATATACGCAATTAATGCAATGTATCGTAAGTGTTGCTGCTTGTTTCTTCTT
TAATACAACGTAATACATTTATCGTGTTTGAAATGTATGAATCCAGACTGACTTCTCCCGGGTGGACACGTGCAAGACTCAACGACACAAGAACTGTGCC
GTCGAATGCACGCAAATGAGCACAAAACTCGCCCTGGAGATGCTAATTAAGGAAACATGATCTGACGTTCACTCTTGCATTCGTATGAAGGCCAGAAGAT
TACTTCATTGCTCTTGCGAGCGAATCAGTGGCTGATTAATCGATGCGACTACAAGCTAAATACACACACTTAATTTGAAGCGTATCCCTCACCTGAGCCC
AAGTAAAGATCTCGCGCAAACCGATGTTGTACTCCTCAGCCATGCGAGTGAGTGTCGTGTTAGCACCGTGCATGAACTCAGCGCCCATCTCAATACTGAG
CCCCGGGATGAAGCTCGTGTTGCTCATCACACGGCCGCCCACGCGCTCAGAGGCCTCCACGACCAGCACGTCCTTGACGCCCTTGGCGTGCACCAGCTGA
CTGGCGCACCGCAAACCGGCAACACCAGCGCCGATGACAACCACGTCGTGAAATTCAAGCTCGTCGGCCGGCATTGTGAGTCGCTAGATCTGAAATGGCT
CATGTGCAGGGCATGTCGATTGTACCGGAACCCACCAATCGAAGAGTACGTTCATAATTCAAGCTGTGTGGCATGTTTTGCTGCCATGCTCAACTTGACT
GGACAGCAGCCTGCTCAGAAGAAATGACTTAGATTTAGTAAGGTAAGCGTACAGTGACATCCAGCGGGGGGGGGGGTACAATGCAAGACAGAACAAAACG
ATAAGTTG