Description :
From Genome Similarity Track
Location :
Scaffold_70:251610- 253623
Sequence
2013 bases(100 bases per row)
CGCAACCCCACTGCAGTCCCTCAGAAAGGAAGGGTACGGGCGTGTTAGGCCTTATACAGGGGGACCAAGGTAAAACCTCGGTAGGTAGACTAATACACTC
AGGGACACTCTAATCCCACAAATATATACTGAACGATACTCTAATACCGTTCCTGCCTCTCCGGCCACGCCAACGCTTGGCGCTGCCAAGGAAACTCTCG
GTCAATGCACGATAAGCTCCCCGACAGGCATCCACACGCAGCCGAGCGTGTCCAGGCACTACACTAAGCTAGCTACACTTACCGAAGTCGGACTTGACCC
TTGTTGGCTTTGGGGGAAGACTGTCTTTTTATTACTGGGTTTTCTGAGGCCCTGGGGGCCTCGTTCTGGCCATCCTATGATGAGTCCTATGTCCCTATAC
AAATATCTAGTGTGAACGATCGCAATAAGGCGATTCCGGACACATCAAATGACGACCGCGGCTACACTAATAAGTGCGGCCGAAGTACGTAACTAAATGC
ATCTGTACCTAAAAGTGGGTACCATGAAGCCTCGTTCGGGGTTGTATTAGGACCCGACGAGGCTCCGGCCACTACCTGTCACTCCAACGAGGATAATGTC
ACCAGCTTAACCAAAGCAGCCACTTCCATCTCGCACTTGGCTGCTCCTTGATTGTACCTTGATTCTTGGGCGATGGGCAATCGCTCCGGTAATCTCCATT
TTCCGATACCACAACTGCCCCCGCTTGGACACGAGCCTCAGCAACAGGTGAGCGTCTAGGCGCCTTCCGTCCGTCAACGTCATGGTTCATTCATTGCGCT
TGCGCTTGACCGCTGAGACCGCCGCTCTCCTGGACCTTCAGTGTTCTGGTCCGGTACGCTGGGCGTTCTTGCTGCTCTTCGCCATCAGTTGGATCCTCGT
TAATGACGCCAGCTTATCCCAGGGTGCTGTCGATGTAGTCACCGACACTTTGCAACGTTGGCTAGGGTCGCAAGATCTTTCATTACCTACCGGTGGTTCT
GTTGGCGCTGATAATACGGTTCCGGTGCAAGATGCAACTGTGACCGAGCCTCCAGTGACTTCCGTCGCTGCTGAAGTGTCGGTCGACACACCACAAGGTT
CCTCCAGTGATATTTCATCTTCTGCTAGGGCCACCGAGGATTTGAGGATGCCTGGAGCCGCTACGTAACGTGCATTCCGGTGGTCGTATGGTCCGACGTT
GGTTGTTCGGTCGATGCCCCGCGCACTGCCCCTGGGTTACACCTTGGCTCCGTTTCCTCGATGACATTGGTGTCTGCTTTAGAAAGTGCTGCATCACCTG
AGGGTCAAACTGAGCAGCATGCCCTGCCACTCTTCTGGCCGCAATACCAATCTACCGGAGTTCCGGTGGTCGTATGGTCCGACGTTCCATCGACATGCTG
CTGACCGCCGCTCGTCACACATCGTCCGCATACTTCTCAGCGTCGCTGACATCTTCTGTAGCTAGTTCTGCGTCGTTCGATGGTTCAACATCAACTGCAG
TAGTCAGGGAACGTGCGATGACTCGTCCAGCCTCGCACCATTACTACGTCGGAACTTCGGTGGTCGTAAAGGAGGCAGGTATGGTTGCCCCAGCTTGAAG
CTCGCGAATCGCTGCACAGCCAACGTCGGTCACATCATCACTTGCTTCGTTATCACTCAGAGATAGTGTAGCTGTGTCGACCGTGGTTTCGTTGCCTTCG
TTCCACAGTTCCATCCGGATTTTCCGGTGGTCGTAACCAATTCGGGTTGAGTTGCCTCAGTCTGTGGCTCGGCAACCACCGCACCAGAAACATCGGTCGA
GCCTTCAGCTTCTTCCTCTTTGGCGTGAGAAACTGTACCAGTGTTGACCGTGGTTCGTGATCCACTTACAGCAAATACTCGGTGGTCGTAACGTAAGGTC
TGGGTACCACAGCCTCCATCAAGCGACCCGCTGTGTTGCAATCACATCTTTTCGAGCCGCACCAATTCTCGTTCAGGGTTCCCACAGTTTCCGCGCAGGC
TACATCAGGCACC