Description :
From Genome Similarity Track
Location :
Scaffold_140:25160- 27677
Sequence
2517 bases(100 bases per row)
CGGACGCGCGTGGGTTACAGCCTTGGTGAGCCATCACCTCACCAACTAGCTAGCCAGCTCCTTCAGGGCTTCTTCTCCCGCTTCCTCCCGGCCGGCAGAC
GCCAGTGCCAGCGTCCACCGGATGCTCAGTCCGCCGCAGCGCCGACCGTCGAACTCTCTCCTCCCTCCCTCCTTCTGAGCCGCCGCTTACCACCCGCTGC
CAGCAGTCGCTGCGTCTCGGCGGAGGAGCACCCAACGTCCTCCTTCTCTCCTCTCTCCTGTCCTGTCCGTGGCGTCCAAGGGCCTACTCAAGAGGCGACG
GGTACCTGGTCAACGTGCTCCATGGTGTCGTCGAGGGGATTCGCTAATGGCTGGCGGCAGGCGAAGGCAGAGCTAGCGGATAGCCATTGGCTGCGGTGTG
CTACTTCAGTGATCTGACGTGGTCCACACGTGAAGTGGCCATACTGCAAGAATAAATAATTCGTTGAATCGAATCGAGCGTCCGAAATTAGCCAAAGGGA
TTTGGCTCGGTTTCGGAACTTGATAGTTGTCGAAACCAAGTAGCATGtccgaaattagcctgggagaaatcctgcctgcaagaacgcatacccagtcttc
caaacagacgaacacaagaAGAGGGCCAACCTCTCACAACTATTTAACATCTTCAGAGGGAAGTGCAATTGTCCGATACTTACTGTACATGTGCACGCAT
TGGACTCCGCTGGCAGATTGCTCTCCGAGATCAGTCCAGCGTTCTAGGAGCCAGGGTCAAACGCTGAAGAATGAAGCCTGCCAAAGCACACGTAATCGCA
AAACACGAAAACCATCGAAAGTAAATACGGAGTTCTTGAGGATCATGCAGCACAATTTGCTGGATTGAGAATTGCGCTTGTGAAGTGTGCAAAAATTGTT
GAAATTATCATGGAGTTGATTTTGCCATCAGCATATGCATGCAGTACATGGTACACATTTGTAGTCAAGTACTGCATGTACTCCGCAAAGGTTGAACGTC
TCCGATGCTGTAGCGGCTACACGTACAAATAATGTACAGGGCCCATTTATGGAGGAGGTGGGATTACATTCTCCAAGCGCGCCTCGAAAGACATGCATGC
ACATATTGGGCCGTCTCAGGAGGCGATTAACCGTGGCGCTTTGTACTATCTTTTCATATAAATTCAGGCGTTCTCGTCTGTGCTTGTCTGCAGTGTACAT
GTAATGGTTTAAGTGTTCGTGTAGCCAACTCACACCTTGCGTTAGTACTGTATAGTGGAGATcgcaagtgctggcgccacctgcgatgcgtgcagtggcg
acgagaacgacctgcgacgactacagtgacccctccagctacaaaagacgaaactactcatgcatattaggctagtccagcatttctagcagcatccaaa
ctaattcgttctgcaaagaacgcaatatacctggtgcgaggcaccactacaaggagcaaccttCACTGTATCAGCTTTGCTAGTCGGCGATAATGCTTCT
TGGTTGCGCAGTGGCGGGCGGCAGCTCGCTATTTTCGAGACCGAACGTAGAGAAGAAGAGcccgaaaataaagtctcaaacgctttttttcggatatgac
gtatccgaaaaaaagcaatcgggcacccgaaattagtccgggaataacccattcccgaaattaactcggcgagtctgccaaacaggcggacacaagatcg
cgccatagatctttctggatccgggagaaactgttttgcatagttccgtccatattcaagttggcgcgtagtgagCAAGGAAGGGGCAGTGTACACTCAG
AATTCGTCTTTGTCCAGTTTTCCCCGACTCTGCTTTTTAATACTGTCAAATAAAAAACACTTTATTTTTAATAAAGTGCTTTTTATTTGAAACAGTAACC
AAACGTAACCCTTGAATACAGCTTTCAGAATCGTCGCTGGCTGTGGGGCGGCGGGAGACGGAGGAAGTCAAGGCGTCCAAGCAAACACCGCCAATGGTAG
CCGAACGTTTTGTGATAGTTTTTTTACGTACTATATCATGACAAAACACCTTTCCGGTTACTTCCTAGTGTTTCTGAGATCCTCTATTAAATAGACATAA
ATtttatgttctattaaaactatagtcctgaattttctgtaggctgagcctaaagcgttgtctgatggccttcctgggcttgtagtgcgcatccaacgct
gcctgagggagtcttggattcttggagagaggcttgtacaatcaaaaataccggtgggtagtattccctacgagaagtttggtttcgtcagcaccagagt
tgggttatagtctaggcgtagcgaagtaggaggtttctgacacttgagcttgagaatggaaacccaaaagtgagaggaccagttgtgttgcatcggggaa
cgcccgcaagcgaaaaaaaacgtacggcacccagtaactactgcggctcACACTAGTGAGCGGAAGAGGACCGCTCGTGGCcacaatcctttctcggaga
gctccgcagagactttc