Description :
From Genome Similarity Track
Location :
Scaffold_263:2516- 6261
Sequence
3745 bases(100 bases per row)
GCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGGTCATC
TGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTAACTTGGATCCC
CCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATT
GTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAGCTGCGCAGCAAATCCGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAG
TTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATG
TTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCC
GGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGACCATCCAGATCATCTGGGTCGAACTCATCATGGAAGTTGTCTGCCTCCACTGACTTCATT
TCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGT
GCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGCGGCCGTCTGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGA
CGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGGATTGTGTCAGATCACGCGTGGGGCCTACTGGATCCCGAGCCTTCACGTTCACA
GGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCAT
CCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAAC
TCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTA
AGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGAGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGA
TCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTG
GTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTAC
GGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGG
TCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCG
ATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGAC
TCACGGTGAAATCCCGAGTCACCAAAAGATCCGGCACGCGCACCATTGTGGTGTAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGAAGACATGAACAAGCACGCGTCAGGCGCGCTTGGGGG
TTCTGAGATCCTTAAGAACCCCACGCATCCGCTGTATCCTTTGGTGACGGAGTACGCGGATGTCGCGAACAAACACCCACCGACCCAACTCCCACCGGAT
CGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAGCAGTGCGAGGTTATTGATGCCT
TCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTTCGTTCGGAAGCCGAACGGAAAGTGGCGTCT
GGTTCACGCTTATAACAAGCTCAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACAAAAGGATGTGCTGTTGAACAACATGGTTGGGAGCGTACTG
TACAGTGCGCTGGATTTGGTAGACGGATACTACCATATCCTGATGCGAGAGAGCGACATCCCGCTCACTGCGGTAAGCACTCCAAGCGGCATGCTTTGGG
AGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTA
CTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCG
AACAAGCTCTACGCTAACATCGACAAGTGCGTTTTCGCGTCACCAGTGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAG
ACAAGGTCAAGGTCATAGCAGCATGGCCGACGCCCCGATCCCTGAAGGATCTTCGAAAGTGATTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGG
GAACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCC
AGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGCTTAGCGTCGTCTGCGATGCCTCCGATTATGCCATCGGATATGCATTGCTGC
AGGCCGACACGGCTGGACACGAACGAGTCATCTCGCTCCAGTCCAGGCAGCTCAAAGCCACCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGC
AATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCG
CCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCAAGCAAGCTCAACGTGCTTGCGGACG
CCCTCTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGT
CGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAG
GGCCTCCGCTATTACCGGGTGGAGCCCACGGATCCTCCGCGGGTG