Description :
From Genome Similarity Track
Location :
Scaffold_383:2516- 3911
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_383-snap-gene-0.22Vertebrate sel-1 suppressor of lin-12-like (C. elegans)

Sequence
1395 bases(100 bases per row)
CACCGCCAGCTTGAGTCTCAGTAGAGCCATGGCATGCCACACCGCCGGCTCGGCCTTCCCAGCCAGCAAATAATACAAGCCCGCTCGCTCTCGCGACAAG
GTCGCCCCGCCGTCGCCGTGCTCGTGCATGAAGCCGATGCTGTAGAGCGCTTGTCCGTTCGTACCATGGCTCAGGTAATCGGCTTCCTGGTAGTTTGCGA
ACGCGGCGGCGTGGTTGCCTCGACCAAACTCCCAGTCACCAAGCCGGACCAACGCGTCTGGACTATTCTGCTCCGCTGCTCGAGCCACCAGCCGAATGTA
CTGCCTTTCTTCATTGTCATCGAGAGATCGCCACTGTCTTCGCTCCATCAGCCAGGCCGCATTGCTCTGGGCAACTTCCGATCCCGTCTCTGCTGCGATT
TCGTACAAAACCCGTGCGCGGTCCCAAGATCCAGCGTTGAACAGCGCGAGCGCGGCATCGAGAAGCCGTTCCACTTCGACTGCCCGTTCTGCGACGCGCT
TGTACAGCTGCACCACATCCTTGCACATCGCGAGGGACGACTCGGTCGGCTGGGTTGATGCAGTTGGTGCGTGATCTCGCTCTCTGAGGCGCGCGAGCTC
ATAGAGCGAGCCAAGATGACCCACCTCGGCGGCCGCAGCGAAGTACTCGTGCGCGTGCGATGGGTACTTGTCGGTGAGCAGGACGGCCATGTTGTACACT
CCATCGGCATGTCCGGCATCCGCTGCCAGCTTGAAGTACTCCATTGCTCGCTTGGCATCGACCGCGACTCCGCCAAGACCCTTCGAATAGACCAGTCCCA
GTCCGTTCGCCGCCTCGACAGCGACTGACCCAGCCTCGCGAGACAAGCGAAGGGCCTTTTCATACAACTCCACGGCGCGACTCACGTTCTGCGGTTCGCC
TGCGAGTCCGAAGCTGTGGACGTGACCCAGCAGCGCTCGAGCCGAGTAGCTCCCGTGCTCCTCGGCTTCTTCTAAGAACTGGACGGCTTCGCGCTCTCGG
TCGGCGTGGTCCTGGTCCGCGCATGTGTCGTCGAGAGCGGGACAGAACAAGCCACTGAAGAGTGCGAGGCTCGCGTACCTGTGCATTGTATCTGGATCGC
GAGACGACTTGGCTCGATGCCGCAGGTACTCGGCTCCAGCCAAGTCGTCTTGGTCGCGAGTCGGTCGCAAGTTGTTGCTGGTGCTTTGCTGGTTATCCGA
CAGCCGTACAGCTTCGGATCTGGCATACATTTGAACCGGAAACAGCGAGCGCTTTGCCTCCGCCGCGATCACTCGGGCTGCAGCATGCCGATAGAACGCC
AACGCTGTGTCGCACGACTTGGCGACATGGTAGCCGTGAAGGTGCGAATACCCGAGCGCCAAGATCGCCGGCAGCGACCCTGCTCGGCTGGCAAA