Description :
From Genome Similarity Track
Location :
Scaffold_1294:2515- 5411
Transcript NameFunction/comments
Phyag_g10190hypothetical protein PHYSODRAFT_547810

Sequence
2896 bases(100 bases per row)
CTCGGAGGCTTCGTGCTCGATGAGCAAGGGGAGGAAGACCTCCTTcgggaggcgctgcagaccgTGCGCGACCAGGGCTTCCGCATGCAGCGCGCAGTGG
ACGCCGCAGACCAAGCAGCCGTGCTCAAACACGCTGCCGAAGTGCTGCGGGAGCTGCGCACGAGTCTCCTCTCCCCCAAGAACTACTACCACCTCTGTAG
GGCTGTCACTTCCTACCTAATACCGAACAAcacgttggcgttgctgaTCTATTAGATGTTGCCAGATATGCAGGTGACGGATGAGCTGCGCCACTTTGAG
AGctacgtggacgagcagcagcaagcgggCGCCTCCATGCGCGTGCTCTACGAACGCGTCCAGAGCAGTGGCAACGTTCTGCCGAGACTGTACGAATGCT
ATGATGTTATTGAGCAATGCAGTATTACCAAAGGGCTTACGTTAGTGTGTTACGGTGCAGCTACTTGCTGGTGACGGTGGGCTCGGTGTACATTAAGTCG
CGGGAGGCTCCAGCTCGTGACGTGCTGACAGATCTGGTGGAGATGACAAAGGGGGTGCAATACCCGCTACGAGGGCTCTTTTTGAGACACTATTTGTCGC
TCAGTGTTCGTGATAAACTGCCAGACACGGGCTCCGTGTACGAGCAATCGGGCGGAGGCACCGTCAGCGATGCTGTCAatttcctgctgcagaatcttcG
AGAGACCAACCAACTTTGGATTCGACTACAGCACCAGAAGATTGGAGGATCGAGGCCGCTGGCTGTACGAGAAAAAGAAAGAATGGAGCTGAGATTGCTG
GTTGGAACGAGTCTTGTGCGGCTCAGCCAGATGGAGGGGGTGACACGCAGTGTGTACGCTGAACAGATTTTGCCTCGGCTACTGGATGACGTTGTGCTTG
CCTGCAAAGACTCGATGGCGCAGCAGTATTTGATGGACTGCATCATTCAGGTCTTCCCGGACGAATTTCACCTGCAGAATCTTAAAAGACTGCTAGACGC
TATGGAGAAGCTCCACCCAAAAGTTGACGTTGCGTTGATTTTGACAGCGTTACTTGAAAGACTCACCAAGTTTAGGGAGGCACAGGGCAGCGTCACTAGC
ATGgggcagcaagaagctgatgTGGACGATCGTACAAACGTCGAAGAGGACCAACAAGAGGGCCTGAAGATTTTCCAACAAGTAATGACTACAACGTcaa
cgttgctgctgcgatcgTCGCGATATGTCTCAGGAACTGGAGGGTCCCCAAGCGAAGATAGCAGTGGCGACCCACACTTGGTATCGGTGCTGCCATTTTT
CGTGGCGTTTGCGACCTTCACACTCGCATGGTCGGGTAGCAGCAAGATCAAAAACGCAGgcacgacggcggcgctACAGCAGATAATTTCTGGGTGTTTA
ACGTTTTTGCGTGAGCGAACAGCATGGCGCGTTGACAAAGATAAGCAAAAGCGCCAGCTTGTTGTTTCACAGCTCGAATCACTCGCTCTCACGCTCCTTC
GAGTGCTCTCCATCGAGGATCTTATGCAAGTTCCGGCGCTGCGTGAATTGCTCGCGCTGATGCCGTGGCAAGGTGCCTGGAAGGATGTGGCGCTGGCATG
GATCCGTGTGCTTCTATCGCGACATGAACGTGTTCATAATGAGAAGCAAATGGACTTTTTGATACAGGTACTGGCACCTCTAGTGCGTGACGACCCCAAC
GAGTTGCAGTCACCTCCGCCAGCAAGTGCAATTGAAGTGGGCAAAAGCAAGAGTGTTGAGGTATTTGAAGCGGAGCAGCAAACGCTGGCCAAAATCGTGC
ATCTTGTCACCAACGACGACCTCGACGTCAAGTTTCGCGTGTTTTCCGTGGCACGACGTGCATTTTTGCAGAGTGGCGTTTTCCGGATTCGTTTCACACT
GGTGCCATTAATTTACCAGTCGTTAACTCTCGCGCGAGATCTAGCAGCTCGCTCCGAGGAGAAGACCCAAACTCAAGGGCAGGAGACCAAGGCGGAGTCA
GAGAGCGCAGGATCTACAGGAAGCTCCAAGATTTTTGTTACGACACCTCGCGAAGTTCTTCAATTCGTGCATGAAATGGTGACGGCATTGGCTTCCAAGC
AGGACGCGCTGTCTGTTTCATGTGTCCACTTGTTTCTACAGTGTGCCCTGGTAGCCGATGGATGCAGATTCGAAGCAGTAGCGTACGAGTTCATCACGCA
GGCATTCATTGTGTGCGAAGACCAAATCACACTTGCACGCGAGCAGTGGCGCGCGCTGGAACTGATAGTATCGTCACTGCGAGCCACCCGCAATCTGTCG
AGTGCCAATTACGAGGTTCTCGCAACGAAGACCACACAATACGCTGCTCGactgctcaagaagaacgagcaggCCTTGATGGTGCTGAACTGCGCACACC
TCTTTTGGGTAGGTTGGCATTGAGAGGTGCTGGATCTTGGTAAAGTTCTAACTCCTCATGTGccattttgctgcagcatccgtCTCAAAAGGATGGCAAA
CGTGTTCGAGAATGCCTTCAGCGATCCCTACGAATCGCAGATGCAATCAAGGACACAACATCGAACCAGGTGCCGCTTTTCCTGGAGATTTTAGAGGCGG
TGCGTTGCTTACGAAGTATTTGGCATCTCGCGTTGGTTTCTCGATCGATCGCTAATTGCCGTGCGGCTTCATGTTGCTCCCATGCAGTATTTGTACTTTT
TTGAAATGCAGACGCCAGAGGTGACGCGCAATTACCTTGTAGGcctgctggcgctggtgaaGGACCACCTGGACAACATGGAGCACGGGCAGATGCGCAG
GGAGGGCGAGTTCCGTTATCGCGCCATCGTGCGATACATGGATGCCTTGGGTATTTCAGATGATGCACTATCGACGTCGTCATAGTCGCCATTGCG