Description :
From Genome Similarity Track
Location :
Scaffold_246:25142- 26283
Transcript NameFunction/comments
Phyke_g8151ABC transporters ABCA family

Sequence
1141 bases(100 bases per row)
GCTCATTGAGGTCCAACGACCTGACCCAAACAAAGCCCGACGACTAACCTTTCGCGTGGCCAACTCGAAGATGCCGTTGTTCAGAGTGTAACCAGGGAAT
ATCATGAAGACCCACCGTAGGTAGTTTCGGTCGAGAGACGAAAGCGTCAAAGAGCCCGAAATGGTGAAGTTCACGATGCGGCACATGAACGAGAAGATGC
TCAGCAAGCCGCCGGTGCCTAACGCAAATACGAGTAACGCGGTCTGTGCAACAGCATGCTTGGTGTAACGTCTTGAAAAGAGGTACGCCAATGGGATAAT
TGCCCAGATGTGAGTGACCACCAACAGTGTAATCGCTGCAACATCTTCTGCACTCGCATTTGCTGCACCATTGGGCACCATCGATAGTGGAATAATTATC
ACAGCTGCGACGATCGGAACAATCGTCAAGAGCGCGTCGTGTGTCCAGCTCGCTAACCAATATGCGGAGATGTTGGCGCCGCTGATAAGCTGCAGACCCT
TAGCGTTCTGGACGGGGTCCTTCTCGCGCACGACGAAAGCCACAATAGCTGCCGGGACGAACGCAAACGCCAACATGACAACGAGCGCCACCAGAAAACC
ATTCAGAGTCACTTGAAGCTTCgcgttgttcttggcgaGGCAATTATTATTGAAACACGGCGATGAGTCGCACGTGTTGCACGGGTACCATGGCGACGCA
ATGTTGGACACGTCACAGCATGCATTGGCGTCGCAGCCAATAGCACCTAACGAACAGTATTCGAAGCCCCGAGGACCCAAACATGCCGAGGCGTTGTAGT
CTGCATTGACAAGGCTGTTGAAACTAGTAGTCGAGCACTGACTCTGTTGAGCTTCAGTCGGAAGATTCGAGGCATAGTTGGGGATAAAGTCTGCCACCTT
GACCTCTGGGAGCACCGCGAGAATGATCAAGAAAATAAGCGGAATGCCCACCGAGTACACCAGGGTTTTCTTGTCACGCTTCGCGATTTGGAAGCGTTTC
TTCGTCAATGCCATGTACTGGGTCCACATAGTTGGTTCACGGATTGGCGGCATTGTCGTTGTCGATGGTACGTTCAGTGCGCCTTCTGTAGACGGCAACT
TCACTGAAGCATGCCCCatcaaggaagaagagggtTTGCGC