Description :
From Genome Similarity Track
Location :
Scaffold_1769:2514- 3696
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1769-snap-gene-0.3HECT ubiquitin ligase

Sequence
1182 bases(100 bases per row)
CCGCTAGTCGGTGGTGAAGCCGTGCTGCTCGGTCTCTAAAATTGTGCGCAGCATTGTCTCTAGACTATGCCGTGACTTATACAGCGGGATGTCCAGGCGG
TTGAAGCACGCGTGGCTGACAATGTACCCCGTGGACTCAGTCATCTTGACGCCAACGAGCGTGAACGGGCACAGTCGGCCATCGACACTGGTGAGCGCTG
AAAACCCTCCAAGGGGCGCGCGTGAAGACCCGGTCGCGAAGAGCAGCAACCTGCGACGGTACTCGTTCGGCATCTCGCGCATGATCTCCCAGAACCACTT
GAGCGTGTTCCCGTGGCGCTGCAGATTGATGCTCACGATCGTACTGCGCTGCCACTCATCCACGTCGATGTCGTTTGAGCCGCAGAGCACGTAGTCGAAC
TCCTNNNNNNNNNNAGGATCAAAGAGCATCAGCAGCTCCTGTGGGATGATCTCGTAGATTCCTTTGAGGAATACAAAAAGCTGACTGGACACACTCTCAA
AGAGCAAGTACCGAAACTTGCGCTCCAGATACAAGTCCTTGTTGTCGTCCGTCACGTCGATATCACGACCGTTCTCGATCAGGTCGACCTCGACCATTTC
GCTGTCACGCTGCTCGGTGATACTGAACGTGAGTCCTAGGTCGCCAGCGCCATTGTTCCGCATTATCCACACCAGGCTCTTGTACGCCTCGGGGTCAAAG
TACTGCAAGTCCGGGAACGACAGCGGCACGCCCAGGATGATCTTCAACAGCGGCAGCGCCAAGTGGAAACTGAGCGCCTGGCCTTCGAGCAGCGACCTCC
CCACGAGTCGCCCCGCTGCAAAGTAGTACAGCAGGTGATCGATGTCTTCGCCGATGTCGTGGGCCGAGTTCGGATTCAGATAGAACGTCTGCTCGACCTC
ATTGACACATTTGAAAATCCCATTGACTGGGTTCGCCAGCTCCCGGTTCAGAAGCATATGCCACTCACGCTGAAGCGCGCCTGCGTCGACGCCGTGACCG
CCTGCAAACTTGACCCGCATCACCGAATGGATGTACGACTTTGGGATCACACTCAGCGCCGTCAGTGAATCGACCAGCAAATTGTCGGGCGAAATGCTGA
GGTTGATGTACTGCTTGGTTACGTGCACGAGCGAATTGGCGGTCGTGGTCACGAAGTGCGAGTACTTTGTAGGAAAGTCTTT