Description :
From Genome Similarity Track
Location :
scaffold_97:25125- 33504
Transcript NameFunction/comments
Pl_109834conserved hypothetical protein
Pl_109835hypothetical protein PHYSODRAFT_262111
Pl_109836hypothetical protein PHYSODRAFT_506356
Pl_109837conserved hypothetical protein
Pl_109838hypothetical protein PHYSODRAFT_561468

Sequence
8379 bases(100 bases per row)
TCACGATGGAAGTGGTAGTCCTCGGTTGCGGACCATCCTCGTCGGTGCCTTCGATGCGTTGTGTGCTGAATCAAAATTGCACCGTGTGTCTTGAGGCGCA
CACTAACCCAGATTCCAAGAACCGTCGACTCAACCCAAGCCTGCTAGTGCGAAACCTGAAGACGGACAAGAATGTTCTCATCGACTGTGGCAAAACCTTC
CGTGAGTCAGCACTCAGGATCTTCCCCAAGATCGGAGTCTCTGTGGTGCACTCACTGGTGCTGACACACGATCACGCTGATGCATTGCTGGGTATGGACG
ACCTGCGAGAGGTTCAAGCTCATGTGGAGACCATCGACCCGGTGACCAAGGAGCTGTACAAAATCCCACCTGAGGCCATGAAGGTGCACTGCAGTGAGCC
TACTAGTCCCGATGTAATTGCCAAATTCCCATACCTGATCGACAATGAACCTCTGCCTCCCGCTGGTGAGGCAGCGCCGAAGCCATTCCGATGGACGGCC
AAGCTTCAAATTGACACGTTCCATCCATGGGAACCGTTCGAGTCTTGTGGTATCATGTTCCTCCCTTTCCCAGTGATTCATGGCGACGGATACACGTCGT
TCGGATTCGAGTTCGGTCAGGAAGTTGGTGCAAGGTTTGTCTACATTTCAGATGTGAGCGAAATTCCGGAGGAGACAAAAGCTTTCTTAAACGATGCAAG
CAAACCTCCAGTTGATGTTCTCTTGATTGACGCGCTGTACTTGGATAAGTATCATAGCACGCACATGAACCTGCAAACAGTGATGGAGGAGATCTTGACC
TTCAAACCGAAGCGTACATTGCTTACGGGTATGAGTCACGAGTTCGATTACCCCAAGCACAGCATTGAGTTACCGAAAATGGGCGAGGAGAAGGGTTTGA
ATATCGAAATGACCTACGACGGACTGCGTATCAAGTTCTCTTGATCATGCCGACTTTATAGAATTGGTCTGCAACGACATGATGCTAAGTATCATCAACA
TGAACCATTTTCCACAGTAGATGTATATCCTTTATTATGTTATAACTCATAAATGAGCTCGACATAGTTCCACAACAAATTCAGGAAGGTGCGTATCGTC
ATCTCGATGAGACGTTTCGTAATTGATAGATCGTCCTAAGCGTGAGGCTTTAACAAGGTCTCATTTCAGATTTGCGTCGCTCGTACCCCGATGGAGGTCG
TGATCCTAGGTTGTGGAACATCGTCTTCCGTGCCATCTATGCGTTGCCTTTTTGGCAAAGGTTGTGATATCTGTCGAGAAGCTCAAGCTAATCCAGACTC
CAAGAACCGACGACTCAATCCCAGTCTCCTCATTCGGAACCTTCAAACCAGCACTAACGTGCTCATTGATTGTGGCAAAACTTTTCGAGAGGTATCACTA
CGGATCTTTCCGAAGATCGATGTCTCCGTTGTTCACTCTGGTGAACCAAAAGCTTCATCCAAGAAATCATGCCACGGGACTGCCAAATTCCGAGTGGAAG
TGTTCGATCCGTGGGAACCGTTCACGGCTGGTGGCATGGAGTTCTTACCCATTCCAGTGACACACGGAGTGGGTTATACGTCCTTCGGTTTTGAGTTTGG
CCACGAGTTTGGTACGAGGTTCGTCTACATCTCAGACGTGAGCGAATTTCCGGATGTGACTAAAGCGTACCTCAACGATGCCAGCAAACCACCGATTGAC
ATCATGATGATCGACGCATTGTACCTGGACAAGCGCAACAGCGCGCACATGAACTTGATGGAGGTGGTGAAAGAGATCGAGACGATTCGTCCGAAGCGTA
CACTTCTCACCGGAATGAACCACGAGCTGGACTATTTCACGTATGGTAATTTGGTCAAGGAGTTAGGCATTGAGAAGGGGCTTCACATTGAGATGCCCTA
CGATGGAATGCGTCCTTCCTTTCCTTGAGTTTTCGAGCCATGATAATCAACTCGCAAACCAACCTTTTACACGTTTTGTATTTTCATAAGCCTACTTGAC
CGTGTCCGTGACTGCAGCATCGACGCTCAAAGATGTAGCATCTGAGAATTGAGCGTTTGAATCCACCTCATTTCTCGTTTCGTCAGATGGCGAAGGAACC
AACAGCCCAGCCTCATACATAATGTCATTAAAGACATCGATTTCCTTGGCCACAGTGTTAGCTGCGCTGAGTGCAGCAACTGACGGTACTGGGAATAGGC
GATGAAAGCATTTGACAAGATATGGCACGAGCTCAGCACGAATGACCTGTATGAATGCAGACATTACTGTTAATTAAGTGGTTCACAAGCAATCGAATAA
AATATAGCGGTCGTACCTCATTCATGGCACGAACAGAATCAGTTAACGCTACTGCCCTTGCCTTCCTTGGAGTAGTCTTCGCTCCTTCCTCATTGCTTTC
CCCAGCCGTAACATGTAGATCTAACCCGTTCTCCTCAACGAAATCGGCGATTGTGAGCAACATGGTGCCGATTGCGCTCTGGTACTTTTTGCCCAAACGA
TTCTGCAGAGAAGAGATTGCACACAATCTCAATTCGTTGAGTGAAGACAGCAGTGCGTTGGTGAACTCTGCCAGCATAGGAAACGACATCAAACATCGCG
GAGGTGAATAGTCTTCTCCATCGGCGGAGGTTGCTGCCGGTCGGGAGGCGAAAGGGAAGTTACTGCCACTTCCATTAGCTGACGATCGATATGATGCTAT
CACGATAGGCGTCTTAGATGATGCCGAGAACGTGGAACCACTGGATGCCGACAGCGAGTGCGCGTTCAGATTTTCCTGGAACTCGCGGCAAGCTGATCGC
CAGTACTCTGTCATCAGGTTCAGCACGTGATCCTCGAAGTACACGACTAGCACGGCACGAAAATCTACCCCGACACGACCGAGGGACCCTCCAAAGAACA
AGCTCTGTTCGAGAATCGTCGCAATCGAACTGAAATCATCGACCTTCGGAAGTTGCCTGCACAGCGTTCAAATTCAAGTTAGATGACATCGGGCTAAGCA
ACACATCGTGTAGATACGATAGCATGCGTACTTCATGAGAATTTGGATAAAGTTAGCAACCGTAGTCGTTGCCCAGCGACAGAGTGGTGGATCCACTTTG
CCGTCTACATTCTGAGATGCGACCGACACAAGCAAGAAATAACATTATTTCTGCAAACTTGCTAGAAAGATGAATATCAAGACCCACGTACCTCGCTACC
GAAGATCGCCGAGTACTGAGTAATCATGTCAAACCAGCTCGTTCGCTTGATGTCGATGACTTGTATAATCTACACGGCATATTCAATAAGGTTCATCAGT
GAACAGCCCAAGGCCACAAGAGTAACTGTAAACGGTAGTGGACGAACAAATTGATACGGATCGGAAGACGAAATGCCTCGACTCAAGGAGGACAGCCACA
CATTTCTGCAGGCAAGAAATTCCTCCTTGAGCTGTTTTTCGTACTCCAACGACCCCACGGCTGCAGCTCCATCCCTTCCAACAAGGGCATCGAGGCGTCG
GAGATACCCCACGATCCGAACACACAGCGCCAGTTGCAGGTCCTCGCGCAGTTTCTGCAGCAGTTTCTCGCGCAAAATGCTGGTCATCTCCGCCACCTCT
TTTACCAAACAATCTATCACGACATTGCGCGATGACTCAGTATTTTCATCAGCCTGGAACGTCTCATTGGCAAACTGAATCACGTCCAAAGCCGACTCGA
ACAGCTCGTTGTGGATGCATGCCTCCAGTAGTTGTGGGATCTCCAATAACTCTGTCAACTTCACCACAATAATTGCAATAATTATCTAGCTGGAATCCAA
TTTTCAATCATAAATATAATTCTTACCTGTAAATAATGCTCGAAAACAAATTGGATGTCACCATGCTTGGCCACGACGTCTGTTACCTCCTTCTGGAACT
CGACGCAGTAATCCTGGAGACTGGGAATGGTAGCTTCAATCTTAGTGGTCTCTTCCTTCAGCTCCGCAAGCTATGCAACAAAAACAATTATTGGTAATGT
AACATTTAAAAATGATACTCGTCATGGTAATCCGAACATACGTCATCCTTGACGATGGCGGCGCATTGGTTGCTCTGGATGAAGACGTGGTAGTTCTTAA
GTACCAGGTTGCGCAGCTGCTCAGCTGTGTTATCTGCCTGGATCTGCAGACGCCATGGTTCCTTCTTCAGCTCCTCCAGCGAGCACGTCTTGAGCGACGT
CAGTGTCATGTTCGGAATGGGAAGATGGTGTGTGGTACATAATTATTTTTCAGGTGCATCAATAATTCGTTAGCTCAGCGAACTTGCTGTGGCACGGTTA
TAGTTATTTGTAAATTTGCATCTCGGTAACTATGTACATTCTGTTGCTACATTGGTCATTTGGAAGCAGCATTTCACTCATTTCAAGCTCAGCTCAACTA
CTTTTGGTGAGCCCAGCAATGGCCACGTTGCCGAGGTGGATGATCACTTCGACAAAGATGATGGTACACGGCAGGATGTGCTCGTGATGGATCATCAATG
TATTCTGGTGCGGCGAATTTCAACGTTGGGCAAGCCTGTGGGAGGTGGATTTCCAAACGAGTATGTGTACAAACAAACCACTACGTACATGCAGTGAGCG
ACATCAACGAGTCGAACAGCGTCGTAGTCAGAGTTGACACTTGTCAGTTCGACGGTCCAAAGGTGCACGGCGCCAAGCAACAAGATCGCAGCTGCGCAAA
ACTGAAGCAGGTTGAAGTGCAAAACGTCTTCTACTTCAACCCCTACCCCCTCGTTTACGTGTCACTTGCGACTATAGTAAAACTCATATGTGCGAGTTCA
GCAGCCTTATCTGACGATCGATCTTTGAAACGCAACGACCTTCCTCGGTGCGGGAGGAAGGAGCATGTGGCCGCGGCGTCGTCACGCTCTCGGCTGCACG
ACACAATATCCCTCCTCCCAAGATGGTATTCCCCAATTAAAGAGATTTTCCCACTATCAATTTCGCATCGAAAACCGCACAAGACCTGACAACTGCAATG
CTGACCCGTAACGTCCCGCTGATCTCGCGCTCCTTAGGCTCCATTAGCCGCCGCCATTTCGCGGCTGCTACTGCCTCAACCAGTGCCAAACGCGAGAAGA
TTAACGGTCATGGCCACGAAGCGCAGCAAAGCGGCAAGCTCAGCTATGTGCCTGAGGGTTCCGACGGACGATTTTTCATCGAGCAACTGTACGTCACTTC
GTAGCACTGCTTCATCCTCAATGCAACTCACTTACTTGCTTTCTACAATAATAGGGATGAGCATTGGCGCTCGGCTGTGGCAGGCCAGAACTTCAAGAGG
GACGATGTCATTGGCTCGGCACCTGGCACTCTGGTACGATGCTCGTTCAGATTATATTTGAGACCATGGGCTTTGATGACTCAATTCTTGTTGTGACATC
TTTTGGACAGTACTTAAAACCCACTCGGTTTACAGTTCAGATCACACCCGACAAGCACATGGATTTCACCGGCGGTCTGGAGTTTGTCAATCATAGCTGC
AATCCCAACACGCGCATCGATATGGCCGAAAACGAGGCGAAGGTGTCCTTTATCGCCATCAAGCCGATCAAGGAGGGTGAACACCTGACGTTCGATTACA
CCACAAGCGAGTGGGACATGGACGAGAAGTTTGACTGTCGTTGCGGTGCACCGATTTGCCGTGGTCACATTGGAGGCGCCAAGTACCTCAGTGATGAAGA
GGTGAATGCTCGCTTGCCGTACTTCACACCGAGCGTACTGCGTCAATTGTTGAACCGCAAGTTGACCAACTAATTAAAAGTGAAGCGGTGAGAGTGTCAA
AGCTTGTAAAACCTACTTCGAAGCTAAAACTAGACTCGGAAGATCAATAAACTAGTATGACTAAAAGCTGCCATTTTCTCCAAAATCTCTCCCATAGAGA
GATTTACAAACGTGTAAGGTGTGGAGGATACTTTTCGGGGTTTGAGGCTAGTGCCTGCTTCCACTGCTCCAACGTGTTGATCACACCTGATAATACTTGT
TTGTCCTCGATGCGTACTCGAACTGCAAACGCAAGACGAGGGTTCAAGTCGGCCTCTGTCTTCGCCAGGATCGCTTCATCCTCTTCAAGTCTGTTCAAGG
ATTAATGGAGTGAATGATTAGCGACGCGAATAGATTAACCATTGAAATACAAAGTGCACGTACGTAGTTGAATAGTTCGCGAGTTTACGACGGCAAGAGC
TCTGTAGGGTTTCATAAACTGCTAGTTCATTACGCGAGCTGAGAATTGATGATTCAAAAGCCTGTTGTTTAAAGTGGAGGGACAACAACATTACAATTGA
AATTAAATTGATGAGATCATGACTTCACCTCCACAAAGAGCCACCTTACCTTCTTGTACAAGCGGATTTCCTGTTCGTTCATCAAAATCACTCGCAACGT
AGCCAGTAGTCTCTCGTCGACATCGTTTTTGAAGAGGGTACCGCAAAAATCGTATGTCTGCTCTTCAGTGAGCTTGTTCGAGTCAAGAACAGTCTGCTTC
AGCTTCAAATATGGATCAGTCGGTGGGATCTTCATCCAGAAATCCACCGCTCGACGTGGATTCTCCTCTGCAACGAATCCGTATGAATACAGCAGCTTCG
CATTCGAGTATTGTCCATAGCTAATATGCAACGGTGACCCTGCCGTCACGTCTTTCGGTACATGGTGAGTCATCATTTGCTTCTCTTCATCAAATGAAAC
GAAGTCATCCAGCGGATTGCGCAAGTTTACGTCATGGTTGAACATATCCATCGCCGGACACAGCACCCGCAAGTACTTTTCTCCTTTGCTCACACCAAAG
GCACGACTCCAAATCACACTCATAGCCCACACGTAGTCCTCCACTTTGAGCGTCGGTAGTGATGAAAAAATCGCTGGGAAATCCTCCACCACTGCTTGAT
GGATGTTCTCAAAGTCCCTCTGCAACTGTTGTTTCATCAATTGCGTAAGTAGCAGCACATTGGTACCCTTAAGTTCATTCAGTTCTGCATTCGTCCAAAA
GACTGGTAAGTCGAATGTGGTTGGCATTGACGCGATAAACGGGGCAAAGAACGAAGTGTTGCCTTTTCTGCGTTCGTGTATCAAATGAAGTGCCAGCACC
TCGTCGTCTGGAATCTGTGGATATTTCTCGAGTACTGGCGCAAGGTCCGATTGAGCTGCAGACTCGATGTTCATGGTGAGTTTGAAGGGAACCCGCAGTG
TGACTTGGCCACTAGTTAACGCTTGCTTAGCAAATACTCCATGACCTTCGAGTTTGCCTAAGTACTGGATATCCAGCAAGTTATCGGCGCTTCCATGGAA
CTCGAGCCACTTCAGTAGCGCTGTCACAACCTCAGGAGAGCTCATGTTTTGGCTGGCTGACAAATCGAATATTAATTACTACAGATCTTCAGATATGCAT
GTATAGACTTTTGGGGGTATTTTGGTGGTCGTATGGTACCAATAACTTCAAGAAAGACCGTCATGTAGTAGGTCGCTGAATATCATGCTCGTGATTCTCT
GTTGCAATTCTTGATCTTGCTGAGTTTGAAGCGATGAGAGGATCGACGTGCTCTTGGCTCGGGATATTGGCGTTCGAGGCAACAAAGTTACTGGAGTGGC
TTGGACTACTGATGAGAGCTCTTCGGTTGTCTTGCTCAGATCGGACTGGACTTTGGACACGATGTTGTTGACGTTAGATGCTACGCAGTTCTGCGATAAG
AGCAAGTCGCTCGTGACTCCAGATTCAGCGTCAGTTTCGTCAGAAAGCAGTTGCAGTTGGCGCTCCAGTTCGTGTTCAGAGTGCGCTCGAATCGCGAGGA
GCTCCTCGATTTCGGTTTGAATGTGCCTATGGATGACTGAAAGCATCAATGAGTTGTCGTTAACCGAAGCACACTGCTGGATGGCGTTGAAACAATCACG
AGCGAGGTCTTCGACAATATCGTAGAGTGCGTGAGTGGCGGATGAAGCATTTCCGACATCTAAGTTGTCAAATGGTGGGAGCCGAATCTGTTTGAACCAA
GAAGATAGTTAGTTAACTGAACATCAGCACATAGTTGCAATGTGAAGAAGTACCTCTCCATCCACGATCTCAAGCTGGTTCACAATTCTTTGTGCCAGGG
CGTGATCCCGAGTTGTTGGATCCGGTCCAGAAGCACGCTTCATAAACTCGCGAGTTGTTTTTACTGCAGTGGGTATGCTGGATGTCGACTCACTACTGTG
TGAGCCACTACCTAGTGTGTGACTGGAAAATGCAGCTACAGGGCGTTGGCTGGACCAAATCTGTAGCTCCGAGTCCAGAATTTCGTCGAAGACGGTAGCG
AAAATTGCATCAGCTATCAGCTCGCTTTGTCGTTCCTTGTCAGGGACATCATTCGTATCCCGCGATACTTGTTCAGATT