Description :
From Genome Similarity Track
Location :
Scaffold_47:25125- 28043
Transcript NameFunction/comments
Phyag_g1158hypothetical protein PHYSODRAFT_472228

Sequence
2918 bases(100 bases per row)
CGTGATGAACGACCGGCAAAGCGTGCTCGCCCCGAAGCAAGTGGGCTGTTCAAAGAGGTCCAACTCCCGCATCAattgcagcaaaagcaagcGCAAGCAC
GACCTCGAAAGTCAAAGCGAGGCAATAGCAGCACAAACAAAAGCAGTAGCGCCAACAAAGCAAGGAGCAATCAAGACAGCCTCCTTCGTGAGGCAGTCGG
TGCAAAAGTGAAGACCCTTACAACAAACACTCGATTAGCATCAAGCGCTAGTCAACCTGGTGGAACCgacttgctgcgtcgcgcCGCTACGCCATCTATC
ATGAAGACACCCATAGCACCTCTACTTCACAGGACAATGTCTGAGCGTTCTAACTTCCTTCAACCTGGCGCTGTTAAAGTtggaggaactgcagcagcca
gaacTCAGTCATCAGCGCCCGGCGGATGTGCATTTCGTCGGGCggcatctgcttcatcgGTGGTAATGGGGACGCCCGATAGACCGAAGGGAATGGCTGC
GCGAACTGCCAGGAGGGTTTTGGTGGAAGCATCGCCGCCACTTCGCAGGCCCagcggagctggagcttctgcgcctcgtcttcttcaaccgAAGTCGTTA
CGACCAGGTGGCAACCCTCCTCCACTTTTTCGTTGATACTGGAACGAGTGTAATAGACAAAATGTAGACCTGAATTGCCATCTCTAGCTTGCcacgttgc
cgtcgctgttATCACTATCACTGTCGCTGCCATAGGCCACTAGTCCAAGCGCCGCTGCATTCGGTTTGTCCTTTTTCGTCTTCGGCGATTTACTTGATTC
CTCcattttcaccttcttcttcgctggttCCTCTTTGGGTTTATCAGAAGACTGTGCAATCTTGGAATCACTCTTGCTCGGTTTCTCTTTTCCAGCCTTC
CGCTTGGCTCGCACCacaaccacagcagcaggcttcTTGCTTGCCGCCTTCACGGCATCTTTTACCGGATACTTTTgcaagtgcagcgccgtAAGAGGCA
TACcagctgcagaaccagcTTTTGGGGCACCACGCGCTACCACTACAAAGACAGCCAAATACAAGACCGTTAGCTATCTATCTACCCGATTCATCAGCAC
AGTAGCCCATACGGAATTGGGCGAGGTCCTCTTCGTGTTGCGTTCGGCGTTTCCGTTCGGCATCTcccttcttgctctcgaGGTCGTTAATGTATTCGAA
CTCCTCATCATCCAGACCTTTTGGAGGTGCTGTTACAGATACGACAACATGGTCAACGATCGAACATAATGTGGAGAGGTAGACCCCACATACCAAAAGG
gttgttcttctccttccactcGCTatccttcttctctcgaCGCTCTTGCAATTGCTCGTACAGCGGCTTGTAGCCTGCTGCGTCCTCTGCTCGAGGGATC
GGAGCCTCTGTCAcacgcttctcctccacatTGTCGCCAAAGAGCTGCACAAAAGCAGAAGAAAATTAGCGTTAATGAGGAGATCCTAGAAATGTGAGAA
CAGTGTATATGCTCAGACCGCACCCCATCGGAAGATGTGAGCACGGAGGTGGACACGAAGCCCGCCAAAGACGCCATTGGGACCccagcgctgccaccac
TGCGCGAATCCATTTGTAACTATTTTGTGATTATTTTCAAGATGTAAGCGTGATATTTCATTTTCATTTTAGACATTAGAGAAAAAAAATAGTATTAAAA
TAAATAGACTCAATTATTTCAATTCCGCAATCTATTACAGTCGCATTTTACACTCGACCAAGATGCGAACTCGGTGGAGTCGAATGCTGACGCCTAGCTC
TTCTAGGTCCCGATCAGTTGCCTGTATTAACAGGGCACCATCAATGCCAAGTGCACGAAAATTTGCGCCGtagctgccgtcgtcgagcCCCAGCGAGTCC
AAGAAGTACTGCACCTCGCGGACTCCCCACTGCTCCATACGTAGACCTCGGCATTCAAACTGCTCGTTTTGTACCTCATCCGATGAACTTCCCCCGAAAT
TTTGCGGCCGTCGGTTTGGAGTGGACATTCCTGTGCTACGCTTGTACTCGTCCGCTTTCGCTTTGGATAACGACGCATTCACGCGCAGAACCAGATTGTT
GCggatctgctcgtcctccgGCAGAGTTGTCTCGAATTCCGAAGAGTACACCCCCTTCTTGGGTTCGCGGTGCGCCAACTCGGTAGCAACTTCTGACTGT
AGTTGAGAACGCGTAACAGCTCGCAGGTCACCTCCCGATCCACGACGATGGCTCTTTGTCGTCCGATAGATGGCCTCTTTCCGTTTGAGCTCGTTCATGC
GTTGGTACAAGTCACCCGAACGGAATTTGAGGTCGTTTACTAGACCACCGATCCGAGTCTGCAACCGACGGCGTTTGTCCACTAGGATTGTTTCTTCAAG
GCGTGCTTGCAaagcagcaagttcgtcTCGCATAGCACCTAACTCGTGCTCAGCCTGAGTTATCAGTTCTCGGCTAAGTGCAATATCCTCGCGCATAGCA
GCTTTTCGAGGGTTGGTTGAGACTCGAACGGGATCGACAACATTGCAACTTTCGTCTCGGTTTGCAACTTGGACAGGTGTTGGTTTTGGTGTTGGAGCAG
TAAATCCGTTGGTAGCTTGGTTTGTTGTTTCTACGAGGGTAGTGTTTCGCTGTTGTGTTGGTACTTCGAGCGGAGCTACGGCAGTAACAGGGTTGCAATC
GGACTCAACCGTCGAATGGGTAACAGCCATCGGGTCAGGATGTCCACGTGATTGTCGAATCTGTCGACGTCTAGCGTCCGCCTCCCGTTCCCTCAATAGC
GATTTAGACGCAGAAAATACCCGCCGCATGCTAACATCGCCAACCCAGCTGCCGAACAATTGAAGCGCGGCGTCAGGTTCCGGTTCACGAAGGACTGGGT
GATCTAGGTGCATCTGAG