Description :
From Genome Similarity Track
Location :
Scaffold_5:251115- 256379
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002564Similar to adcD: Arrestin domain-containing protein D (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G002563Similar to DSPP: Dentin sialophosphoprotein (Homo sapiens)

Sequence
5264 bases(100 bases per row)
TTTCTCACGCAAGCCACGAGTGACTTTGGGTCACCTACCTCTGCTCCGTGCTCGCCATGCTCACTCGCATCCGCGTTGACTCCGTGTGGATCTCCTCGTG
CCTGGGAAGCCGAGTACAAGGTGATTGTCAGCCAATATCACAACCAGAAGCTCCACTCCGTTTGCTCGATGCTAGGCGATTACCTGGAATGCAAGGGTGG
AGCAATCGTTCTTGCGAATGATCAGCATATCTGGGTTATCGCGCACAAAGGACTTCGCACCAGTGTGCTGCACTCGGACACATTCCTGTCGATCTGCCAC
AATGCGATGGTTGGTCGTGCGCCTTTCAGTGTGTCAAAACGGAAGCGATCTGCCGGTCAGCAGCACTATGAGGCAGGCAACCACAACACCTTCCACTTCT
TCTCCGCCGTGCCGATCTTCCGTGCAGGGCGCCAATCGCCGCCGATGGGCTGCATTATTGCACTCGACACGCATCCTCGAGACGACACATCGGCCCGGAA
AGTCGAGAAAACGATCCAAAATCTTGCACAGCTTGTCATCAACCTGCTCGTTGAAGAGAAGACGATTCTGCGCATCTTCTCGTCGGGCGACTTTAGAATC
TTCGCGTCCAACGGGCTCGACCTCGCGCCATCGAACTCGACCTTGTTCGAAGAATTTGGCGTTGCTCCGTCTCCAAAAACAGCCACCTCCTCAGCATCCG
CGAGCTCGTCGAAAATGTCGCGCTCCAGAAGCTTCGCTATGGGGGACGAGCATGCCAGCTTCTTTTCTCGATACGCTGATTCTGGCCTCTGCCCGGTCAC
CGCTGCGTCGCCAAGAGGCCTAGACCGTGCAAACCGCAAGCACGCCGCAAGCAACCCGGAGAAAAAGAAAAACGTACCAAACTCTGCTCCACGCCAATGG
AAAAACGATTCAACATTGCGGGCGGCTTAGCCAACAACCCGTGATTAATTTATCTCTCTCGCAGCCTGGATTGCTTCGTTGTATCTGCCTTGGCCGAAAT
GAGCACTTCACTAGCCAAAGTGAGAGTTGAGTTTGTGAAACCACAGCCACGTAAATAATATTAATAATTGCGTTATACCAAACCTATTGCTTGCATCCAT
CAACGAAGATATCCCATGTCGCGCTTGTATAGTGCTTTCTCTCTTGCCGTAGGTCGATCGCCAAACCAGTTGCCACTACTCGAACGCTTCTGGAACCGCT
TCTTCTTTCGCACATCAGTTGGTTGGAAGATTGCTTCAAGATCGCACGTATCAACAAAGTCAGGGAAAATTGCTGGCGAAGGATCAGTCGCGTTCGGGCC
AAACTGAGCACGCAAGGTCTTCTCCAAGTTCTCTTTCTGGGCCCACTTCGGGATATTCTTGCTGTTGTGTTTCTCGTCAGAGTCTTCATCGCTTTCCGAG
TCCTCACCATTATCAGACATGTCGTAGGTGCTAGTATCGGCTGGTTTATCGGCTGGCTCTGGTGTAGTCTGCTGTGGAGGAACGACTTCAGAATTTGCCA
GTTTGGTGGCCTTTGTCGTTCGGTCGATTGGATCGAGAGTTGCTTGCTGCGGAGGAGCGACTGCAGGCCTCGCTGGTTTAGTGGGTTTTGGCGGCGGTGC
CTTTGACTTCATTTCTTGCTCAGTTCTAGTCGATTTAGTCTGTTGAAGAGCAGTCGCCGACTTTGAGGAAGTCTGTTGTGCTACTGCAATTGGCTTTGCT
TGTGGAGCAATAGTCGCACTCGATTTTGATGCCTGGGAAGTCGAAGAAGAAGAAGAAAGTCTTCGAGATGACGGCGCAGTGTTTGCCATCGCCGCCTTCT
TCATACCTTCTTTCTCTGCTGCAAGCATCGCTCGCTTTTTCTCCAAACCTGCACGCATTTCTTGCAGCTTTTGGTGTCTTCGTTTCGCCAGCTCAACTTC
CCGTTGTTTTTTCTCGTTCAACTTTTCTTGCTCGCGCTTCAGTTTGGCTTCACGTTCAGTTTTTTCTTTCATGCTAACCGCCTTCTTCTTTTTGTCTTCG
TCCAGCTTTCTCTGCTCTTCGTATTTCTTCATCAAAGCTTCTTTCCGCTTCATCTTTTCCAAATTCTTCTTCTGCTCTAGCAATCGACTCTTTTCTGCCA
ACTTGAGAGCACTCACCACAGGTGCGCTGCGAACCACGTTCATGGTGGACGCGCTTGCGTTTTCTTTTTCCACAAGATCCGTAAATGAATGCAAATCGCT
GACTAGATTTGTGAGCTTGCGAGCACCTGCAGTTGAAGCTGAAGCTGGCTTGGTATTTCCTTCATTCCCAGACTTGGACGATCCAGAAGATTTGGCTGAA
GCAGCAGAATCTCTTCGCCTGGACAAAGATTCTCTTCGGCTGGATCGGGATTCCCTGCGACTTGAAGCAGACAGTCTGCGACCGGAATCAGAAAATCTCC
GGTTGGAAGTTGAGAACGGAATTGATGGCTCCTCCTTCGATCGGACATCAGATGTCAGAGCGGACTTTGATTGGGACGAATTGGACGCAGATTGATCTAA
CAAGGATTCTGTCACGAGGTTCTTCAGAATCTTCGTTTGAGCATTTGGTCGAGCTGAACTTGTGCTTTGCATGCCTTCATCCTCGACCGACTTCTCCATT
GCTGGTTCAACCTTAATGTTCACCACGTCAGTCACAGCGGGTTGCACAGCACTGGTGGTGGAAACTTCCGGTGGCGAAGTGGTTTGCGTCTGATTCTTCG
TCTGATCTCTTCTTGACCAGAATGAGCTACTCAATTTAGCTTCCTCAAACCTCTTTTTCGCAGATAGCTTCGCTGCAATACGAAGTCGCTGAGCTTCTCG
TTCAACATGCAGTTGATGCTCTAGTTTTCTTTGGTCGTGTTCGGGCAACGCTGATCCACCAATTGGTTGAGAAGGTACCCTCCGGTTCAGCTCCGTTTCT
TCAGACGAGACATTTGTCACTTGGGTGCTCGGAGTCACAGGGTTCGCTTCGCTGATCGAGCTGGATTGCGGTAAGGATAGAGATCGTGATCGACTGGCAG
AGTCGCTCAAAGTTGCTGAGCTGGAAGGTATCGCTTGCTCAGTTTGAGAATCTGGAACAATCGAATCATCATTTCTTGACGCAAAGCTGACTTTCAAGAG
CGCCTTTTTGTCCTGGGCACTGTCGCCTGAGATCGTCGAGTGGCTCGTCTTGCTACTTGGTTCCATTGAACTTGCCATGCTGACATCTTCGTTCAGAGTC
ATCAACGAGCGTTGCATCACAGACTTAGTTCCCGATTCCATGGACAAATCGGATGTATCGGTCTCACCGGTAATTGAATCTTCCTGACGGTGTAATGTAG
CGGGCAAACGTTCTAATCCAGCGCTTTGCGTGACGCTTCGACTCGCTGGGTCATTCTCGGGTTCATTCGAACGTTTACGTCGTTGGGTCTCAGAAAGCTG
GGTGTTTCTAGAGAAGATCGAGGATGCATTCTTTGCAGACGACGTCTTTGCGGTCATGATGGGCTCATCGGTATGGATTGATGCGGTCTGCGCTGGAAGT
GAGTCGTCAGCCTCCGTAGATGCAGTATTGTCATCATCTATTTCAGCATCATGCAATTTGCTTGACGTAGCCACTTCTTCAACTCCGACGTCACTTTCTC
GGACAATCTCGTCGTTTCTTTTCGGCTTTTCATTTGAAGATCGATTTGATGGGCGCTCAGTATCTTGAGTCGTCTTCTCTTGCGAAGATCGCGCTGCGGT
ATTTGCTCTGGCCAGCATCGCCGTGTTTTTGCTTTGTTCTGCATCAGTCTCCGTGAGCGCCTTTTCCGACTGGTCTGGACTGGTTTCAGCTTCCACATCT
TCCTCGACTTCAACTTCGTACTCCTCGTCGAGTTCTTCCATTTCCACGTCGCTGTCACTACTGTCTTCCTCTTCAATCGCTTCCAGGAGCCGATCCACTA
GAACTGCTTTCAAACCAGCAGATTTGAGTCCTCGTCTTTTCAGCTCAGCGCGCAATTCCACGACTCGCATATTGATAGGATCAATGGGCTCTTTCCTCTC
GGGTTTCTTCATATTGCGCTTCCTGTCCGTTAGCATCTTCGGCTTCATCACTTTTCGTATCCGCTTGACGATTTTCTTCACCACTGTTGGCTTTTTGACC
TGCACAGCGCCAGAAGTAGCAGCCTTTGGGGCCATATCGGCACTCTTCGCCACGACAGCGTCCAATTTCTCCGTGGCCACAGTTTCCGTATGCGTCTCCG
TCTCGATCTTTGCTGTTTCTACATGATCGACTTTCTGCTTCTTCACTGCCAGCGTGTATTCGCTAAACACACATACGTATCACATGGAAGTGGCAAGTGA
GTCTCCAGCCTCACGCATTATCATGCATGAACACGATTACCTTGAATACGCCGTGGGCGTCGGACGCTTGAGATCCAATTTGAACACAATATTAATCTCG
GAGCAGATCTTGTGCAGTTCGTCGCGAAGCCACTCAATGCTGCGGCCGTGCGTATCCTCGACGCTCGCAAAGTTCTCGCGTGAGAGAGCCTGCAGGTGCT
TCTGCACGCGCAGCACGGCATCTCCCATGGCTCTTACGCTAATGAGCTTGCTTCTCTCCGCGTGCACTCGTATACCGGTAAAGGGAGGAGCTCGCGCCTT
CGTTCACACAGCGATAGACGATAGAGAGAGATGCCGAGACGCGTTTGTTGCTTTCGTCCTGCGTTCCCTTTCCTGGTGCGCGCGCTTTCAAAAGTTTGAA
AAAAAATACATTGTGGGAGGGTATCCTAGTTTAACGTGGCTTTCGATAGGGCTAACCGCATTCGTATGCTTACACAATTATCCACACTATTTCTATTTAA
ACTGTACCTGATAATGTGTGGTGTACTCTATCTAAACTGACCTTCATTCTTGACGACCCATCCAACCTCTCTAGCATATAGAGAGGTATTGTCCATGACC
CCAGAAAGATGATCGTGAAAAAAAGGGGTTTTCGTCCTTTCGCGTATCCCTGGGATCCACAGAGTGGAGTGGCCATACCAAGTGGACAGATTGACAGTAG
CAACATCGTTGCAAGTGCGTCGCTGGGCACGAGTACGCAGTCTGAGGGCAGGCGAGCTAGTGTCCGAAAAACCACTTCGCCTTGATGGTCAATCAGCACT
GGTGCGCAAAAGACCAATTGGCGATTTACTATTATCCGCAGTTTATTCAGGAGAGCATTCATAACAATGGGTGCAATGAGCGAGAACCATGATCGCGTGC
ACAGTTGATGGTATGGCTGCGAATGCCCAGCGAGTCGAACTTGCAGCGATAGAATTATCGAAGC