Description :
From Genome Similarity Track
Location :
Scaffold_51:251000- 254650
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15729deoxyhypusine hydroxylase
Phypa_INRA-310PPTG_15730hypothetical protein
Phypa_INRA-310PPTG_15731small nuclear ribonucleoprotein Sm D3
Phypa_INRA-310PPTG_15732hypothetical protein

Sequence
3650 bases(100 bases per row)
TGGTCTCGGTTGCGGACGAGTGCGACGGCATTGAGGTTGGCAAGTCTGGGAATGGCTACGTCAGTGACTGCCAGTCAAAGTAGTGAAAGAGAAATGCTGG
AGCCTAGCCCTATAAGTGGTATTTTAAGTTAAAGTAAAGTGCCTGTAGCCAATAGAAATGAAGATGACTGCGGATTGGTGGAGACTCGAGCCAAGTTGAA
GTGGACGAAGGCAGATCTTGTTGCCTTCAGTGTTTTATTGTTGCTTCTTCCTTTTGCCATGGATATGAGCAGTTCGAGTCTGAGAGTGTCGATTCATTTG
GTTGCACAGAGTCTCTTTTAGGATCATTCAAACCCTATCAAATCATGCTCAAATTTTGTAGTATGATAGACGACACCCGAGCTTTAGTAGCTGTTGACTC
AAGGACAGAGTGGTTGTGTTTCATCATGAAGGAAAGGTTTCCTGAAACCAGTGCCAGGAGCTCGAGATAGTCAATGCATCTGCACCGAAACGCCCGCAGC
GAAAATCGACAATGAGCAACAAATCCGCGAATCGGTAGGTGTGCATAACGCAGAAGTTCTGCGGCAGAATAGAATTTATGGGTGCAACAGCAACATCCAT
CTCCGAAAACTGTGGTTAGTGGCCAGCGATCCATTTCTTCGGCATCTAATAGCGTCGTTTTGCCGCAATCCAGGTCGAAAGTATGGTGTCCTGAGAGCAT
CACCACAAACCTTGTAAAAAAAATCCGTGTAGACCCATGATAGGGAATAAAACTACAACCAACAAAATACGTACAATCTGACATTCGAGTTGAAAACTGG
CAGACGACCGGGAAGCGCAGGTGAGTGGCACTTACATGTATCACGTTGGTCGCAGTTGCATGGCTCCGAGCCAACACCAAGACACTTGCACGCGAGTCAT
CATGCCACCTCAGTTTCTCACTGTATCTCTCCCACCGAAACAGAGAGAAGAACACCCAACGAGGAGCTCAAAAAGCCTTCTCGCCGTTAGGTTTATCAGA
TACCGTTGGCCCACACCAGCAGATTGCAAGATGCAGCTCTTCATCCGCTCGGTTCGTCCGCTGCAGTGCCTAACTCCGCATCTTAGGGCTAATGTACAAC
GACTTCAATGCATACAGGACGCAGGACGGACGCTGACGGTCGCGATAGCAAACCCACGGGCCAAAGTACAGGAACTACTGACGCTCGTGGAGGCCAAGCA
GCAAGGACTTTTCACTCAGGGGTATCTTAACTACGGAGGCGTGCCGCTGCGTGCGTCGCGGTCACTAACAGACTACGGGATCCAGAACCACGCTACGCTG
GACTTGTCGCGACGTCTACACGGCGGCTGCTTCGGCTTCTCCATCCTGTTGTGGATCCTTATCTTCATCTGCTGTCTCATCAGCGTCTGCACGTGTGGAC
TGTCATTACCGGTGGCGCTGTGTCTACTGCCACCTGCTCTTCTCCTGCCGCTCTGCTGTCTATAACTGGGTGTACCAAGAAGATGTATAGACAGCTTTTG
CTTTAGACACGGCAGGATCCATTCGTCTACATGTAAGAACTGCGTCAAGCACGACAAGAAAGTAGCAACAGTTTTCGCGTATCAACAGCAGATATCTATC
AACCAAACTGGCAAAAACAAACTCAAAAATCAATAAAAAGTCACGTCTTCGTCTTCAAGTCGCATCCACAGAGCTTAACTGCAGTCGTCAGCTTGAGTCT
CCTATATCTCAGCCGCCAATGCTCCTTGATCGGTCGGAAAGCCTGCAGTGTATAGCCCGTGAGCATGTCTGTAGCTGTCTACTTGCGCGGTCCTGTGCGT
CTGCGGCCCTGTGACTTGCCGGTCTTTTTCTTCTTGCTGTCCTCGTTCTTCTTGCTCAGCGCCTGCACTTTGCTCAGCAGCGGCGAGTTCTTGAGAATAT
CCGGCAGGATCACAAGCTTAATGTGCGAGCCGCGCACATACACGAGCTCGAGTTTGCTCTTCTGGCCGTCGCGTTGCGTGAGCACCACGTCGCTCAGCTG
GCAGTTCATGCTGTCCTCGCTCTCCACCAGGTGGCCACGGTACACCTCGCCGTTCTTGAGCTCGATGGTCACGGTGCGGCCCTCGCCCTCATGTAGCAGC
GAGATCGGCACCCCCACAGTCTTGGACATGGTGACGGCGTAGCTGCTGGCGGCTGGAGCTTGGGTAGTGGTTTCTATTGCAGATAGAAACGTTAGAAATG
GAGACAATGACATAGTTTCGGTTTAGTGACATATATTAAGAAGTCGATCTGTTAGTGCAACATTACACATGATTGAAGTTGTTATGTTGCGGCAACCGAA
CGTTCAACTTCTTCTTGTTTTTGAGCGTATGCTACATTCGTGTTGCAAGTAGGAGGACTATTATGTCCTAGGAGAGCACACATTGGCGCCCAACAAACAC
TCGTGACGGCGTTGTAATAGTTGTTGCGTGAAAATTTCCAGCGTCTCTCGTTCTCGCTTGAGAGCTTCGCGTATACGACGTACTGGTACTCGGGATTCAT
CAACTAACTGCGTGAGTTCTGGTGTTTCCTCCTTGCTATCCTCTTCATCATCTTCTTCTTCTTTGACTTTCTCCATTCCGTCATCGTCTCCGCTGTTCCG
TGACATTGTACTCTTACTCACGATCGACGTTCCTTGTTTTGCCTTCCACACGTTGTATCTAGCGCCTCCATGCAGACGTCGCGATAGAATCTGCCGTTGC
CAAGATAGCGTTGTCGTCCAAATAGCTTCCGCTCTCGTCTCCATATCTTTCTCTTCCTCGTCGCTACTACAGCACAGCGACAGTGCTTTGATCAGAGGGA
CCCCATCTGACACCATGGCCTTGTTATCATCCACATTCTTGTCACTGGTACCATCAAAGTCTCGTAGCGAAGCACAAATCAGCTCTACAGGTTCACCTTG
CTGAACACGCATCGCACGTAGAGTACCTAGAACAATGCGTGTATCCACAGAGTCTCGAATCTTCCAGTCATAGGAAGAGAACAAGCGGTTCACGTGCTTC
AGCTCACATAACGGGAACTCCCTCGTGATCAACAGTGTGAATTGAGCTCGAGAAAGCGTGCATATTCCTAGCGCATTGAGTGCCCCCAGCTCTCTAGCCA
ACGCGAACAACTTCTCCATGTCTTGTAACACTGGTCGTCTGCACGGAGTTCGTCGCATAGCATCCAGAAGTCTAGCAAATGATCGCCAACGAAGTTTGAA
CCGCTTTTTATACAGCTCGCTGGACTCCTTGCTACGCTGCTTCTCAGGAGAATACCCTGGTGTCTGGACTATAGCTGAGACTTGAGTACGTCGGTGACGG
AGCTGGGGATCAGCCTTCTGTTGTTCTCGATGATCAGCCAGCTCAGAGGTAGCCTCGAAGTGCAGTGTACGGCTTTGCCACTCGGTCATACTTCGTTGGT
TTTGTATCTTCTCCTGGCGTGCAATTCTCTTCTCTTGTTTGTACAAAGTCTGTAATTTCTGCGTTGCTTTCTGTTGTAAAGCTTCTTGTATTTCTCTGTG
TGGCTGGCAGAGTGGATTAACGAAATTCTGAGTGTTAGAAACCTCAACAGGAACTGCGATAGGAGACGACGGACATCGTGTCATTGTTACTCGAAGGCGA
GAGCCACTAGGATGGAACGTCTCTGGAGGCCACAGCGAAGGTGAACCGCT