Description :
From Genome Similarity Track
Location :
Scaffold_51:251000- 252240
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15729deoxyhypusine hydroxylase
Phypa_INRA-310PPTG_15730hypothetical protein

Sequence
1240 bases(100 bases per row)
TGGTCTCGGTTGCGGACGAGTGCGACGGCATTGAGGTTGGCAAGTCTGGGAATGGCTACGTCAGTGACTGCCAGTCAAAGTAGTGAAAGAGAAATGCTGG
AGCCTAGCCCTATAAGTGGTATTTTAAGTTAAAGTAAAGTGCCTGTAGCCAATAGAAATGAAGATGACTGCGGATTGGTGGAGACTCGAGCCAAGTTGAA
GTGGACGAAGGCAGATCTTGTTGCCTTCAGTGTTTTATTGTTGCTTCTTCCTTTTGCCATGGATATGAGCAGTTCGAGTCTGAGAGTGTCGATTCATTTG
GTTGCACAGAGTCTCTTTTAGGATCATTCAAACCCTATCAAATCATGCTCAAATTTTGTAGTATGATAGACGACACCCGAGCTTTAGTAGCTGTTGACTC
AAGGACAGAGTGGTTGTGTTTCATCATGAAGGAAAGGTTTCCTGAAACCAGTGCCAGGAGCTCGAGATAGTCAATGCATCTGCACCGAAACGCCCGCAGC
GAAAATCGACAATGAGCAACAAATCCGCGAATCGGTAGGTGTGCATAACGCAGAAGTTCTGCGGCAGAATAGAATTTATGGGTGCAACAGCAACATCCAT
CTCCGAAAACTGTGGTTAGTGGCCAGCGATCCATTTCTTCGGCATCTAATAGCGTCGTTTTGCCGCAATCCAGGTCGAAAGTATGGTGTCCTGAGAGCAT
CACCACAAACCTTGTAAAAAAAATCCGTGTAGACCCATGATAGGGAATAAAACTACAACCAACAAAATACGTACAATCTGACATTCGAGTTGAAAACTGG
CAGACGACCGGGAAGCGCAGGTGAGTGGCACTTACATGTATCACGTTGGTCGCAGTTGCATGGCTCCGAGCCAACACCAAGACACTTGCACGCGAGTCAT
CATGCCACCTCAGTTTCTCACTGTATCTCTCCCACCGAAACAGAGAGAAGAACACCCAACGAGGAGCTCAAAAAGCCTTCTCGCCGTTAGGTTTATCAGA
TACCGTTGGCCCACACCAGCAGATTGCAAGATGCAGCTCTTCATCCGCTCGGTTCGTCCGCTGCAGTGCCTAACTCCGCATCTTAGGGCTAATGTACAAC
GACTTCAATGCATACAGGACGCAGGACGGACGCTGACGGTCGCGATAGCAAACCCACGGGCCAAAGTACAGGAACTACTGACGCTCGTGGAGGCCAAGCA
GCAAGGACTTTTCACTCAGGGGTATCTTAACTACGGAGGC