Description :
From Genome Similarity Track
Location :
Scaffold_246:25100- 26339
Transcript NameFunction/comments
Phyke_g8151ABC transporters ABCA family

Sequence
1239 bases(100 bases per row)
ATCACTTTTGCCCAGACCTTCAAACAATCCGAAAAAGGACGGGCTCATTGAGGTCCAACGACCTGACCCAAACAAAGCCCGACGACTAACCTTTCGCGTG
GCCAACTCGAAGATGCCGTTGTTCAGAGTGTAACCAGGGAATATCATGAAGACCCACCGTAGGTAGTTTCGGTCGAGAGACGAAAGCGTCAAAGAGCCCG
AAATGGTGAAGTTCACGATGCGGCACATGAACGAGAAGATGCTCAGCAAGCCGCCGGTGCCTAACGCAAATACGAGTAACGCGGTCTGTGCAACAGCATG
CTTGGTGTAACGTCTTGAAAAGAGGTACGCCAATGGGATAATTGCCCAGATGTGAGTGACCACCAACAGTGTAATCGCTGCAACATCTTCTGCACTCGCA
TTTGCTGCACCATTGGGCACCATCGATAGTGGAATAATTATCACAGCTGCGACGATCGGAACAATCGTCAAGAGCGCGTCGTGTGTCCAGCTCGCTAACC
AATATGCGGAGATGTTGGCGCCGCTGATAAGCTGCAGACCCTTAGCGTTCTGGACGGGGTCCTTCTCGCGCACGACGAAAGCCACAATAGCTGCCGGGAC
GAACGCAAACGCCAACATGACAACGAGCGCCACCAGAAAACCATTCAGAGTCACTTGAAGCTTCgcgttgttcttggcgaGGCAATTATTATTGAAACAC
GGCGATGAGTCGCACGTGTTGCACGGGTACCATGGCGACGCAATGTTGGACACGTCACAGCATGCATTGGCGTCGCAGCCAATAGCACCTAACGAACAGT
ATTCGAAGCCCCGAGGACCCAAACATGCCGAGGCGTTGTAGTCTGCATTGACAAGGCTGTTGAAACTAGTAGTCGAGCACTGACTCTGTTGAGCTTCAGT
CGGAAGATTCGAGGCATAGTTGGGGATAAAGTCTGCCACCTTGACCTCTGGGAGCACCGCGAGAATGATCAAGAAAATAAGCGGAATGCCCACCGAGTAC
ACCAGGGTTTTCTTGTCACGCTTCGCGATTTGGAAGCGTTTCTTCGTCAATGCCATGTACTGGGTCCACATAGTTGGTTCACGGATTGGCGGCATTGTCG
TTGTCGATGGTACGTTCAGTGCGCCTTCTGTAGACGGCAACTTCACTGAAGCATGCCCCatcaaggaagaagagggtTTGCGCTCCAaggttggcagcag
catggGGTCCCGTCCTATTTCGTGTCGTTCATCCTCGTC