Description :
From Genome Similarity Track
Location :
Scaffold_223:2510- 5452
Sequence
2942 bases(100 bases per row)
CCCAGGATCTCGTCTTCCCCTTTCGAACATTCCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCG
ACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAGTACGCGCAGGAGCGCGAG
TATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGA
GCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCA
GCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTC
CCGGGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGATCTTGTTGGATTTCCATCCGGA
CAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGAGCGTAATCCTTAATGAACCGACTGTAGTAGTTCAA
ACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAA
ACTCGATGGCCTAAGTAATCTACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCA
CTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGAATTCCAGGATCCCCTGGCTC
TCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATGAGG
CGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTTCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGAT
CCGTCAAAGTAACTACCCAAAAAACGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGG
ATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCC
CACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGACTCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCT
GAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTTCCTTTACCAATCAGCAGATGTCGGCTCTC
CCAGATTTTCTGACGCAGACGGTCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACC
TCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCA
TTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCACCAGTTGGATCTAGTCG
GTCCTCTAACGAGTTTAAGCCCGACGCTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACT
TGTGAATCAGCGGGATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCG
TCGTGGATCCAACCTCCCTTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGT
TGGCTCCGCCGGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGAC
ACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGGCGTTCGTGACCT
GGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTC
TGGCAGCTCCCAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAACTGG
ATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAG
CGAGATCTCCAACCCAGATGTCAAACCAATACACTAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAAT
CCCAACACAGTCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGA
AGGAGTTGCTTTTTCATTGTTGATCTTGCCTCCTACCTTGGC