Description :
From Genome Similarity Track
Location :
Scaffold_1:2509844- 2516020
Transcript NameFunction/comments
Phyin_T30-4PITG_00480Putative uncharacterized protein
Phyin_T30-4PITG_00481P-type ATPase (P-ATPase) Superfamily

Sequence
6176 bases(100 bases per row)
GTACTGGCTTCCCCCGTCGTCCAGTCCCACCCGCAGATGCACATCCACACTGGTTATCCGACGAGCGCCGAGACGACAAAAAAGGCAACAAGTATGCAAC
ATGTTGAAGTCGCCAATGGCGTTGAACCGTGGCTGTAAGATGGCCGTCGTCGCATCCTGTCACTGCAATCCGGGAGTTACGCGAACTATCCAAGCTCCAG
TCGGTTTCTGTAACAGCGATGAACAGGTAGCGCTTGAGCGTGGAAGACGCTAAATGTTGCGAGCCCAGCGAGATGGCCAGCAGCAGTGAATGCAGCACGG
ACTTCGAGGGGCCCGGATCTGCTGTTTCCGGCTCTACTACATGCAGTGCGGCTTCCGAGGAGCAGGAGTACGACGAGGACGACTTCGACAACTATTCGGA
CTCGTTCGAATTGGACAATGAAGATACCGAACCAGAAGTATCCGCTGCTGTTGCGGTCGTTAGATCTACGGGACATGATCAATTGCAAATTGGGATCCGC
GTACAGGTTTTCTGGAGAGATGAGAACCAGTGGTTTGCTGGAGTGATCCGCAGCGTCGAGGAGGGCAATGAACCGTGCTATAACGTCCACTACGACGACG
GCGAACAGCAATGGGAGGTGTGTTCACAGATTATTCATGCAGCTCCAAGACAAAGATATTAATGACTTGTAGCTGCAGTGTCTATCATGCATCCGCCCGT
TTCCTGTCTCGATCGCTGGCACAGCTGAATGCACTCAACTCCAGCAGATGCTGCCGCTGAATGCACACGACGCACGGGCCATGATCGGCAAAAGGGCGGT
AGTGTATTGGTCTGACGAAGGAGAATGGTATAACGGTATTATCAGCGCAGCTCAAGCCTCACCTGCAGCGGTGAAGATTGACTATGACGACGGTGACTGC
CGCTGGGAGCAGGTAAGATCATCATATCTTTGTGTTGCTCGTCCTTGTTTTCATTCTCCGTGTCCTCGATAATATGTAGGAGCACATGTTCCATTCAATT
CTCCTGCTACGCCCGACGATAGAAACACAGCAAACGCCTCTACCTTCACCTTTTGATCCTACAACTCCACCATCTCCGCCTGGGCGAGTGTTGTTTGCTC
GCCCGTACAAGCAAGTTGTTAGCGACCACTTCCAGCCAATACGCATTGCTCGACCGTATCGCTCTGTTGTTGGGCACAGCGGAACTGTGATCATTCCACG
CCCATACAGCGAACGCAGATATCTACACGCGTCTCTAGAGTGTTCACGATACAAGAAGCAAGGCGACACGGCTGACAGCATCGTACAGGCAACGTTATCT
CCATGCTTTCCAGAACTGTGATCTGTACATTAAAACAAGCTTATGCATTCTTTCTACCGCGAACTGACTTGAGAACCTTCTTGATAGAAACGTGTGTTCC
AAATGCCGACTTCGTTTGGTCAACATCGCTTCGAGTTGTCCTAGACGACGCTGCTTCCACGTCGCTGTCCACATTCTCGTCCTCGGAAAACGCGTAGCCA
TGGTACGAGCCGACAAAAGATGACGAACGAGCCCCAACGCCAGCGTTTGCTGTACTTGTGGCAACCGATCCGGGAGCTTCCAGGAAAGATGGCTCCACAC
CTGCATCAAAGCTATCAAAGCTGCCGATAGAATGAAATGATCCTCGAATACGAATATTGCGCTTCTTCTCTCGACCTTGAAATCCTGCCAGCTGATTGGG
ATCGATGGTATCTCCGCCGCTGGATGAACTGGAGAACGGGGACGCAATCAATCTCTCACCAAGAGGAGACGAACGCATCAGAGTTTCCTCAGGATTCTCC
ACTCTGGTGAAGAGCTTTGCATAGTCAACAACGGTAGCTGGTTCATCTGACCACGCTGTGTTTGATACAGATCGACGGTGCTCACGTAGCATGCGTCGCG
GCGAGTTTGGCAAGCCCATGACTTCTCGTTCCTGGAGAATGTGATACATCGAAGGGCGCGAGAATCGGCGGAAGATTTTCCATAAGCCGTCACGTAACAG
ACTCAACGACAGCACAAGAAGGCAAACCAGCCAGAAAGTCGGCAGCTCTTGGAGATACTCCATCTCACCAGTGGCTTGAGGGAATCCCGTGTTTGGTAGC
GAGATGAAGAACCCAACAGCGAACCACAACAGTACAGATACAGTCACTGTGAGCAGGAACTGCCACGTAAGCAGGAACGCCTCCAGACAGAGCTTTAAGT
TCACGACGATCACCAGGTTCGTGAATACCACAAATCCCAGCGTCACAAGCCCGCCACTTTTTCCGGTCTCAGTGGCAATAACGGGGAAGTCACGGATACC
GAGCCCGAAGCCTTCAAATGCCCAAGCAGAAACGAAAAAGATGACGATCGAGTGCCACACCCCGTTAAAAATCCACGGCCAAAATACGCGACGAGCGAGG
AGGACATTCTTCTGTCCAAGTGCATATAGATACGGGAATTTGGCAGCACTGGTGGACGATACATCTTGGTCGAACACGGCAAAGAGAACTAGCGGCACAC
TCGTGTACAGCACGTTGAAACTTTGTGCAGCTACGTCCAAGATAAGCGGCTGGCCGGAGAACCCACAGAAGCATCCGAACCAGAACGTTGTGAGCACATA
CGTCACGTTCTTGTAAAGCATATAGCTCATGAGTTTAGCCACGCGACGATAAGCCCAACGACCGTGAACAAACAGCAGTCGTTGCAGAAAGCGGAATTGA
GCTAGTGCATAGTCCGAAGCATTCACTGCCTGTGCTCCTTCCTGACCGGAAATGCCCACACCGATATGTGCTGCCTGGATCATCGCTACATCATTCGCTC
CATCGCCGATTGCAAGTGTGACGCTATCGGGTTCAAACTCGCAAACGAATTCGACAATATCTGCTTTTTGTTTTGGGGATACGCGACAACAAATGACTGC
TGACGCGCACTGCTGAGTGACTCGGTAGAATAGAGTACGCAACTGAGGGCGAAGCGCGTACTCAAGAGCCTGTCCGTCAATCACGAGCGCTAGCTTCTGC
GTTGAGCCAGTTTGTTGACGGCTTCCACTGCTGTGTATGTTTCCAGCGAGAGAACCATATGCGGGCGTGTGAATAGCTTCATCATCAGCCTCAATCCCGA
CGTCGTACAAAGACTCTTCGTCTGATGTTAACCTATCGGAATGTTCTGCATCCGTCGCAACTGAAGAATACATTAGCGTTTGGCTGAATGCTGACGACAT
CCTTGACGCTCGACGAGTTCGTTGACGTCTTCGCTTTTGCTTTCGCTTTTGCTTTGTTGGCGCTCCAAAGAGAAAATCACTGACAGCTGCCTTCGCACTT
CCCAGGAACGTGTCCGTTTGGATCGAAGCTTTCCGCTTGCCATCACGACGTCGTGTTCTTCTACTTCCGTTAGCTCTAGAAGACAATGAAGCTAGAAATG
GCGATGGATGAGAACATTTCGCTGCTTGATCGCCACGCTGAGATAACTCCTTCAGAGCTGCAGCAGTCGACGTGTAATCATCGCCTCCAATTTGCTGTAC
GTCCATGTCATGAGAAAGCAGCGCACTGGCGTATCCAATGTTCACCGCCGTCTCCATTTTATCGCCTGTGAGCGTCCACACCTTAATATTCGTCTCTTGC
AGTAGACGCAGCGTCGAAGGTACACCAGCCTGCAGTTTGTCTTGAACTGCTGTTACGCCCAGAAGAACCAGATCACGCTCAATCTCGTTCATCAATGGGT
CAATGGCATTCGCACGACCTTGCCGTCGCTTAACTAGCTCTTCCATTGATGCATGTGCTTGCGTATAACGTGCGTTCCAGTCCTCATACTCTTGCCGACT
GATTATTTTATAAGCGAGACAAAGTGTCCGCATACCATCCTTTGCGTACAGTGTAAGCTGGTCCGAAGCTTGTTCATAGGACATCCCACCTGGCATTGTC
GCTTGATCTGCAGCAAGTCGCTCAAAAATGACATTGTCGGCACCTTTACAAAGGAGTTCGATCGTCCCATCTGGAGTCTCCACGACCACTGTCATGCGCT
TGCGGTCGCTGTCAAACTCAAGCACGTTCAGTAATTTATACGAGCTAGGCGACGTCCATCCTGGCTCCAAGAGCATAACGGCGGTGGGCGTTCTGTGCAC
GAAGCGGACATTGCAGAACGCCGCTGCAGACACCAAGGCCTGCTCGTCGGGTGACGACGCAGAATACTCTGGGAACGACGTGCTGCACATCTCAGCTAGG
GATTTCGTGGGAATCAGCGTATGACACAACGCCAAGTGTCGTAAGAAGCGACGCAGCGTCTCCGCCTGCTCTCCTCCAGCGCAAATGTCAGCGAATAGCT
CTGTCGGGTCAAAGTCAACAAATCTCGGACCATCCTTTGGTTCAGCAGCGGTGGAAGACGAATTATCGCTAGGAATCTCAGCCTCCATATCTTTATCCTG
CATGGGACCACCGTAATGCTTCCCTCCCACCGTGCAGTAGCGAAAAAGCATGAGATTCATTGTCAAAGTTCCAGTCTTATCCGTGAATACATGGTGTACA
CGACCCAGATCTTCATTCAGAGCTGAGGATCGTACCATTGCCGGCGTGTCCGACAGCTTGTCGTACATTTCTAGGTCTTGCTCGATAAAATAGGCTTGCC
AATACTTGACGAACTCCAGCGACACATTCAGCGAAATTGGAACAAAGTTTTGCATGATAATGAAGTAGCGCAGATGCAACTTGGCCAGCTCAGCCAATGG
GTGAGAAGTAGAAACACCGGTGAGAGTGTGATGCCGCCGCTCGCTGGCACTGAGAAGATACCAGAACGAATCTCCCTCTGTGTGCATCCAATGGGCACCG
AGCAACGCACCAAGAAAACAGACGAGCTGCTGGATAAATACGATCCCGATAATAAGTCGATTGAGTCGTCGCTCCACTGACGAGGTCTTCACGACAGGCT
CTGTGTTGCTGCAAAATACCTTGGTCTCATGGCCCGTAAATATCACCATCCCTGTGACGGAGCGTGTATTGCGGAGCACGCAACTCCGCAGCATCATCTG
CTTTGCCGTAACCGGTACACGCACACGCACGAGGCCATCTCCAGTCATTTCGGTCTGCATTAGGCTTGCAGTCTGCACTGGAGCATCCAGTTGCGCACTG
TTTGGGTTATCGGCAACTACGCCTAGCGTCTGCGCTTGAGCGGGGCTTAGTACTACTGAAAACGTGCCTTCAAAACTGGTAACGCGATTGTTTGGCTGCT
CACACACCATCATACCACGCAGTTCGTTGTGTTCTCCGCCATCAGTTGCGCGGCTTTTGCTGTTTGACTCGCGACACAGCGCAGCCACCAACGGGATCGC
CGTGCGGATTTTTAGGTTAGTTTCGCCGTCCAGAGACTTTGTCTCAATGTACGCTAAGTTAAACTCCGCTATTTGTTGCTTCGGTGATGCTGGACGCTGG
TCATCTCGGATGTCGACAGAGGAATCTGTTCCAGATTCTTTTCCTGCCTCTAAGTCTGTTGGGCCTTGAAAGTTTGCTTCTTGCATCTGCTCTCGCATCG
GACCATCGTCATCATGCTCCACTGCTTCCGCTGACAGCAAAAACAAGTCCGCAGGGATCGTTTGGTCATTCATCACTTTGACAATGTCGCCTACACGTAG
ATCTCCCCATTGTCGCTGCTCCCAACTGCCCAAGGGAGTCAGGGCCAATACCGGTCTACTATTCGCCACGCGATCAGCTCGATGGCGCTCTCGATCCTCT
AATGCCTCTTTAATTGCGCTACACACGAAAACCACTGCCAGTGGTAGCAAAATAGTTGGGATGCCGCTTGTATTGCTTACTTCTCGGATGGTCTGGAGCA
CAGCGATGAACAGAAAATATACGTTCGAGGGTCGCTGCAACTGCGCAAGAAGCACGCGTGGCGCGAAGTTCCATAGGCTGTACTTAGCGCTCACCACTAC
ATTGCTGGCGAAGGGAGACGGCGGCTCCACTGCATCGTCGTGTGGTCTCTTGGCACCGCCGAACAGCCACGAAGACCGTCGACGATTGCCCAGTCGACGC
GAATCGCGCTCCTCACGACGGCGACGGCGCTGAGCCGCGTTCGCTCGTGCCAGCAGCGTCTTGCGGTCTACGCGAATCACGCGCAGACGCTGGGTTGCGT
CCTCTGCGTCGACTCGAGGCCCCGCCACAGCCTCGGCCTGAATCCGCATCTTGCGAGTAGAATTGCGTTTGTGTGA