Description :
From Genome Similarity Track
Location :
Scaffold_53:250967- 257540
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16089U4/U6.U5 tri-snRNP-associated protein
Phypa_INRA-310PPTG_16090spastin and Fidgetin-like protein
Phypa_INRA-310PPTG_16091elongation factor P
Phypa_INRA-310PPTG_16092hypothetical protein
Phypa_INRA-310PPTG_16093hypothetical protein
Phypa_INRA-310PPTG_16094hypothetical protein

Sequence
6573 bases(100 bases per row)
ACTGTTGATTGATGCTGTGGAGTAGATCCCGCTGTTCACAGTGCTCGAGAAGTATAATGGATCCCGCGTGACACACGTGCTTCAAGGCTCTCACCGACTG
AAAAAGACGTACCAAATCGACTCTCTGCCAGCGTACCTGATCTTCCACGTGAAGAGATTCACGCGAAACAACTTCTTCATCGAGAAGAACCCGACGATTG
TTAATTTTCCAGTCAAGAATCTGGAACTGCGGGATTATCTGAAGCTGGACCAGAATCTGCCAACCGAGGAGGAGCTTCGCGAAAAATCGATCCCCGAACT
GCGAGCTCTTCTTCGCAAACACAATCAGTCGACTGAGGTGCTATTGCTTCTATGTCTCAGGCTGAAGCGTACGAGGTCTAAATGTTTCTCTCTGTCGTTT
GTGGTGCCAGGATTGCGTTGAAAAGGCTGACTTAGTCGAAAAGATCTTGCGAGTTACGCTGCCGTGCACCAAGTACGCTCCGATCCTGGCTGCGTTACAC
TTCACAATAATCTTTACTCACTCTTGTTGTCACTATTTCAACAGATACAACTTGGTGGCTAATATCTGCCACGACAGTCCAGTGACAACTGGCCAAGAGG
CAGCGCTCCAAACGAACCCTCTGACCGAAGGCAGCTATCGTGTCCACGTCCAGAATAGAGTACGTGGTTTGAGAAGCTGTTGTTTGCAAATTCAACAAAA
AAACTGATGATGTACTGTGAATTTATCTGTCATAGGCAACTGAGCAGTGGTACGAAATCCAAGATCTGCACGTGCAGGAAACGATGCCACAGCTAATCGG
CGTATCCGAGTCGTACTTGATGATCTACGAGCGGAAGGCATAAACTTTGGAAATAGAGCTCACGAATCGCGCTTGTCATACTGCAGACACTCCGTACTGT
TCATTCCACGCAACCAGGTCCTGTATCGTTCTTGAGGATACACTTGGACGGACTCGTGTGAGCGCCACCTGAAAGTCAGAAGCGTTGATTCCTCGTACGT
CCTCGGCCTTGACGTTTGCTACTCTCGCTCCAAGCTCGCGAATTGGGCCTAGAGCAGCGTCCTTACATACAGCTTTGAGATCGCTGCCAGAGTATCCTTC
TGTTGCCTTCACGATCTGTTTGAAATCTCTGGATGACATAGAGAATTTCTGGCTACTTAGTAAATGCCGAATAAGTCCTTCGCGAGAAGAAGCATCCGGG
AGAGGCACTGCCAGAGAGCCAACGAAGCACCAGTTAGACATTGGCACTGCCATTTTCACTCTTCTAGGTGACGTACCATAAATGCGCTTCTCCAAACGGC
GAACAATAGCCTCGTCGAGTTCCTGGGGAAGGTTTGTTGCTCCCATGACAAGAATTCGATCCTCTTGTGACGACGCGGCTCCATCAAGCTCAGTGAAAAA
CTGCAACAGCAACCAGTCCGTCAGATGGCTGCGTTATTGCCCTGATGCTTCGTATCGTACCTGGTTCTTGATTCTTCTGCTTGCGTCGTTCTCGGACGCT
GATCTAGTCGACAGCAAGGCGTCGATCTCATCCATGAACACTACAGAAGGCTGCAACTCTCGGGCCATCTCAAACAGCGCTCGAACCAGTTTCTCGCCTT
CACCCACCCACTTGGAAGTCAGAGATGACGCAGAGATACTGCAGCAAACACCCGTAAGTATAACACAGACGTACTTCTCGAGTAACGCATGCAACAACTC
CGAACTAGTTCATACTTAAAGAAGGTTGCCTTGGCCTCTGTAGCGACAGCCTTTGCCAGTAAAGTTTTTCCTAGTAATGCATCAACAAGCACAGCGCTGT
CAGTTCACACTTCGTGTAGCTCGTAATGCACGCACTCGTTACCTGTGCCTGGTGGTCCGAACAGCAACACCCCGCGTGGTGGCGCTCGTAAACCCGTGAA
TAAATCCGGACGCAATGTAGGCAGAATGACAGCCTCCTACTTATACATACGGTAACACAATCAGTGAGTCTTACGTATAACTTCAACATTTAGTTCCACC
ACGTCGCCAAACCTGCAGAATCTGCTTTGCAATTTCCAGCCCCGCAATATCCGTCCAATGCACTCCAGGTGAATGGTCCAACACTTCATCTAGAATTGTA
TGAGCATGCTCTGCATGCTGCTTCGAGTACCCTGTTCTCTGCTGCCAAAATCCACAACAAACAGCACAGCAATGTCAATCTCTCCGTTTTCTTCTTTTTG
TTTGTTTGCGGTCTTCCAACCTGTCGACCACTAGAAGTGGGAGCATTGTTCCCCTGCGTATTCGACACCGATGCATTCTGCGCATTGCAGTAAAACATAC
GTAAAAAAAAAACTCACGAGCACTATTTCCCAATACTCTTCTCTGGACCGACCTGTGTTTGCTGCTTGCGCGCCTGCTCCGCCATCCATTCCTTGATGTG
CTCGGCACGTAGCATGTACTCGTTAATCTTTTGGCGCATATGCGTCTGAGCTTCTTCATTTGGCAGCTCTACACTCCGATAAATGTCAGAACCAGTGTTT
AATGGGGATTTTTATCACTTCAACGTACGAGCCATCTGCGCCATCATCTTTTCGATGCCCGACGCATACAGCTCCACTGCCTCTGCGTATTTCCCAGCTT
TATCTGCCGCCACCGCTTCCTCTATGATCTTCTGGATTGCATCCTCAGGGCGACGAGCGCGCCACAGGAACATGCTCTCTCTAGATGATATTGAAGAAAT
GAGCTGCAAATATCCACTTCCAATAACGATAAAAAATCCACAAAGTTTTATCCAATCATTGAACCTTGAAATTTTGATTAAGCCAATCAGCGCTTTGAAG
TCAACGAGAGGCGCCACCACAATTTGTTGAACGTCATGATGTTGCGGCGAGCTATAACGCAGATCGCACGCGCGACAGCTCCTGCCCGTGGCTACGGTGT
GCGCTTTGCCACGATCAATGGTGTGATCCTATCCACCACCCAACGCTCTCTCTCGTCATACTTATATCGACATCTAACTCCTAGAAATGACTATGATATG
CAGGGAACCAAGTGCGCACGGGTATGGCGCTCGAGATCGATGGAAAAATCTACCGCGTGGGCAAGAACCAGCACGTGAAACCCGGTAAGGGTGGAGCCTA
CGTCCAGGTGCGTTGAATCGCTAGTTTGGATGTAGAAAATCCATGCAGAAAGAGACTCACTAAACGAGTGTCCTGCTGCAGGCGGAGCTCAAGGAGATCA
AGACCGGAGCCAAAATGAACCGCCGCTTTCGCGCCGCTGAGAGTGTAAACAAAGCGCCTCTGGGTCCCGATGAGCCGTTCCAGTTCCTGTACTACAATGG
AGATCATTTGGTTATCATGCACAATGGCACCTTCGAGCAGGTAGGTTGTGTCTTTAGCATTGATGCTACTGGATTCGAGAGTAATCTCTTGAATAAATGG
GCAGATGGAGATCGAACGTGATCTATTCTCGGGTCGGCAGCTGGACTTCCTGCAAGAAGGCATGACGCTGTCGTTGCAGATCATCGAGGGCGATGTGCTT
TGGGCCAATATGCCCGAGCACGTGACGCTCGAAGTGACGGTACGAGAAGTGTATATTACCTTGTCTTCTAGTCTCTTTCGGAATGGCTGAATTTGTGACG
TTTCGGTAACGTTTATTCGCTCCAGAAAACCACCCCGAAAGGTGTGGCGGATACGGCGCTGAGCGTCAAGGACGCGACGTTGGAGAACGGTGCCGTAGTC
AAGGTACCGCTCTTTATCGAGATCGGCAACAAGGTCAAGGTGTCTACCGAGGACGGTGCGTACGTGGACAAGCTGTAGCCATCGCTTACATGCAGAAGAG
GCCTCTACATTGTCACAATTACCACCATTGAAAAATGATGTGTCTTCGTGGACAACTTTGGGCCGATTGACGAGACATACATGACAGTTATCTTACCGCC
GAAATATAATGGCAAGATTTTCTGAATGCATGACCAGCGCACCACTGTGGTGACCACAGCGTAGCAGCATCGACCACTTCGACCGTCATTCATTCAGTTC
AATCGAATGCTAACTCAACGGCCGAGACAGAATCTCAAAACCGAGTGTAACCGTGGCTGGGGATCATCACGTCCTCGGCCTCGCCGCCAATCATTGAAGA
TCGTAGCGGTTTCATCAATTGCCGTCGCAGTCTGAGCATGCGACGGCAGCGCTAGTGTCCGGTCCGAGTCAAGCTTGGCGGAAGAGGAACGTCTCACCTC
GTGCCGTTAGTTGAGGATCTAGAAGCTCATCGCGCGCCGGCTTCATTGCTGATCCCAGTCGACTGGCTGTGCACGGCCCTGAGTACTCAACCCCGCGACC
TTTTACAGTACAGCGTGGCGCACGTCTAACGAACGTCATTCATCCTTTTGTCAGGTCCTCCACATATCCAACGTTCAGCTTCAGTATGGCCAATTCCACA
GATAAAGCATTACCATCTTCGGCTGAGCACCAGCACCAGACAGGCGACTGTCCGCACGCCGTGGCCTCCACTATTATTCAGCGTCACCGCGACAACCGTC
AGCGATTCGATTCGGCCGACTACGTGATGGCGCAGATTGCTGCTGGCCCGTGTGCCGGGTGCACGTGCGGTAAGTGCGCGCCTTCGGACGGCACCGAACT
AGAGCGAGAACCGGAGCCTGGTACTGCGGAAGCTCGCGAACAGCTACGGTGTCTGCGTTTGCAGCGCTTCGACTCTGCCGACTGGGCCTTACAGGCTCAG
CGCGCGCAGCAGAATCCGCAGACAGACTCCCCAGCGTCAGAACCCGGGAACGTTGCGCAGATGCTGATGGACCGACATGCACTCAAGACCTGCGCTTTGG
TGGGTCCCCAACCGGTCAAGACCGACGACAGTGCCAACAAGGCATAGGCAAAAGAAGCAGCAACCTTGTAGCTACTATCCTCATTGAAACGGCATAATAT
ACAGCAAAGTTACGTATCTACGTCCTTTAGACTACCAGATAAGTCGCTGTATCATCTGCGCCTGGTTGGAACAGTTGCTGTTCATGTTTACCCGCTTTGA
GCACGATGGCGCAGCCAGCACTGAAGGCGTCGAGGCTCGACATGAGCATTCGAGGACCCGACCTTGGTCGGCGTCGACAATGCGGCTGGATATAGCCGCG
AATTATGTCCTGGGACTCCCAGTGGGAGGTCTGCCAACACGGACCGGCACTGGTTCTGTATAGCCGTCCCACCAGTTGTAATGCGGCAGGAAGATCTCAA
GCAGCAATCTTCTGACTCAGAAATTGTGAGCGTCGAGCACTGAAAGTCTCCTGGTCAGGTTCTGACCTTTTAGTGCGATGCTAGACTCGCTAAGGAAGCA
CGCATTAGGTACGCTCAACTTAAGTAGAATTTACTTATTCCTTATGGTATCAACCCCAGTTTAACGCTTTCATGGATCCATGCCAGTGATTCTCGTCGCC
ATCCTGTTCGCCACGTATCGCCTATCACGGCTGGAGGGCGAACGCGGACGGCGGGGGGCAAATATCGAGCAGGAAGTGCGTTTGTTATCTGCATGTTCCT
TTGGATCCGATGTCCTCTGACGTCACACCTTTCGCAGTTCGAGACCGTCGTAGGCTTCCTGCATCGACATCTGGACACCAAGTACCGCGTGCTACGCATC
GCCCCACCGCCGCATTCAGCAACCAAACTGCACGCGATGATAGTAAACGCTGGGTTCGCCATCCCACACGTGGGTACGGCGTTGCCTGTCAATTTTTTCT
TTGCTGGTACTTGACCTGCTTATTATTTGGTTTGAGCAGAAGCTGAAGTGTTCGTGGATCAGCAGTTTGCACTGGATCAAAGCAAACAGAAGCGAAGAGA
TCGCCAGCCTTTGCCGCCTGTACACTTTCGAGTATATGACACCGATGCGATGACATCGATTGCTGAGGTATTCTATGTTGCTGTCGTCCGGAACGTGTTG
CCACCGTCTAAACACGAGTAATATTGCAATTCAGACTCTCCAACAGCGGAACCTCATCGCCTCGTACGAACAAGGATATCAACCTATCTAAGCATCGCAT
TGGAGAACTCGATCGCGTCGCTATTGGAAGCTGGACTTAAAGGTTGAACATGTCGATCTCCTCTTCCTCTGCTTCTGCTTCATTTCTGCTCGTGTTGCTG
CTTTCAAGGGCTTGTTGTAGCTGGGCATCGGACTTCCAGCCGAACTGAACGACTGTAGCTGTGAGGTTGTCAATACTGCCTTTTTTGTACGCTGCCTTGA
CGATCGCATCAGCCGCGGCCTTGGCATTGTGGAAGTGTGGTAAAACAATGTCCACCGCGTCTTGCTCGCTCAAGACGTCCCAGACGCCATCAGAGGCTAG
GACAAGAAACAAATCGTCATGTTCTACAATTACTCGCTTCACCTCTGGCTCACACGAAACCAGCGGTGTCGGAGTCTTCAGAGATCGGTCGCCAAATGCT
CGCGAGACCGCCAAATACGTCGTCTTCTCACGTTCCATGGCCAAACCAGCACCAGCTGCGGAATACACGCGGGATAAACCTGCAATCTTTCCCACAAAGC
CACCAGCTCTTTCAATTCTCTGCTGTTCATCGGGACGATCCGGTTTGTGGTCACTTGTCAGCGCTACACCTCG